aa r X i v : . [ q - b i o . GN ] O c t Giant Viruses of the Kutch Desert
Csaba Kerepesi, a , Vince Grolmusz a , b ∗ a PIT Bioinformatics Group, E¨otv¨os University,P´azm´any P´eter stny. 1/C, H-1117 Budapest, Hungary b Uratim Ltd., H-1118 Budapest, Hungary
October 8, 2014
Abstract
The Kutch desert (Great Rann of Kutch, Gujarat, India) is a uniqueecosystem: in the larger part of the year it is a hot, salty desert that isflooded regularly in the Indian monsoon season. In the dry season, thecrystallized salt deposits form the ”white desert” in large regions. The firstmetagenomic analysis of the soil samples of Kutch was published in 2013,and the data was deposited in the NCBI Sequence Read Archive. At thesame time, the sequences were analyzed phylogenetically for prokaryotes,especially for bacterial taxa.In the present work, we are searching for the DNA sequences of therecently discovered giant viruses in the soil samples of the Kutch desert.Since most giant viruses were discovered in biofilms in industrial coolingtowers, ocean water and freshwater ponds, we were surprised to find theirDNA sequences in the soil samples of a seasonally very hot and arid, saltyenvironment.
The discovery of new giant viruses caused a considerable turmoil in virology inthe last decade: these viruses are larger than numerous bacteria and may haveeven more than 2,500 genes [1, 2, 3, 4]. They are parasitic to amoeba cells livingin freshwater reservoirs or seawater habitats. Until now, they were not reportedto be found in soil samples or arid environment.The
Acanthamoeba polyphaga mimivirus was first found in a cooling towerof Bradford, England in 1992, and was later identified as the first giant virus in2003 [5]. Its genome consists of 800,000 basis pairs (bp).
Marseillevirus was found in the biofilm of a cooling tower near Paris [6]; itsgenome contains 368,000 bp.The
Cafeteria roenbergensis virus (CroV) was discovered in the seawater offthe Texas coast in the early 1990s [7, 8]; its genome contains 730,000 bp. ∗ to whom correspondence should be addressed Megavirus chilensis [9] was discovered in 2010 in a seawater sampleoff-coast Chile; it has a 1.2 million bp DNA that encodes 1,100 proteins.Pandoraviruses [10] were discovered in 2013 and they have the largest genomefor any viruses known. Their diameter is close to 1 µ m. Pandoravirus salinus was found in seawater off-coast Chile, and has a 2.5 million bp genome thatencodes around 2,500 proteins.
Pandoravirus dulcis was found in a gardenpond in Latrobe University, Melbourne, Australia, has a 1.9 million bp genome.The Samba virus [11] was found in surface water samples of the Amazonriver system in Brazil. Its 1,200,000 bp long DNA encodes 938 proteins.It is reported in [12] that DNA strands similar to that of the Mimivirus canbe found in the Sargasso sea environmental sequences database [13].In the present work we analyze the Kutch desert metagenome [14], col-lected from soil samples with high salinity levels, for similarities with the DNAsequences of giant viruses, and found significant hits, characteristic to giantviruses, as detailed below.
We have identified six short nucleotide sequences in the metagenomes of Kutchdesert [14] that are characteristic to giant viruses (Table 1 and Table S2). Thesignificant hits with 100% query cover belong exclusively to giant viruses (withthe sole exception of a draft bacterial genome in the case of the sequence U6).Sequence U2 is the subsequence of U1, and it appeared separatelyfrom U1. We should add, that the very short nucleotide sequenceU2=TGCATGAATATCAGCACCATTTTCTACCAAATATTTGAC seems tobe characteristic exclusively to giant viruses if we require 100 % query coverin a sequence search. makeblastdb
Acanthamoeba polyphaga mimivirus : gi | | ref | NC 014649.1 | , Megavirus chiliensis : gi | | ref | NC 016072.1 | ; Pandoravirus dulcis : gi | | ref | NC 021858.1 | ; and Pandoravirus salinus : gi | | ref | NC 022098.1 | ref seq Ge-nomic DB [17, 18]. The results of the alignments with 100 % query cover arelisted in Table 1 and with more detail in supporting Table S2.
We have shown, by our knowledge at the first time, the very probable presenceof giant viruses in the soil of a salty, arid and very hot ecosystem, the KutchDesert. Our result implies that not only the oceans, biofilms in cooling towersor small freshwater ponds, but desert soil can also accommodate these newlydiscovered viruses.
References [1] Didier Raoult, Stephane Audic, Catherine Robert, Chantal Abergel, Pa-tricia Renesto, Hiroyuki Ogata, Bernard La Scola, Marie Suzan, and Jean-Michel Claverie. The 1.2-megabase genome sequence of Mimivirus.
Science ,306(5700):1344–1350, Nov 2004.[2] Philippe Colson, Natalya Yutin, Svetlana A Shabalina, Catherine Robert,Ghislain Fournous, Bernard La Scola, Didier Raoult, and Eugene V Koonin.Viruses with more than 1,000 genes: Mamavirus, a new Acanthamoebapolyphaga mimivirus strain, and reannotation of Mimivirus genes.
GenomeBiol Evol , 3:737–742, 2011.[3] Mickael Boyer, Natalya Yutin, Isabelle Pagnier, Lina Barrassi, GhislainFournous, Leon Espinosa, Catherine Robert, Sa ˘A ˙Zd Azza, Siyang Sun,Michael G Rossmann, Marie Suzan-Monti, Bernard La Scola, Eugene VKoonin, and Didier Raoult. Giant marseillevirus highlights the role ofamoebae as a melting pot in emergence of chimeric microorganisms.
ProcNatl Acad Sci U S A , 106(51):21848–21853, Dec 2009.[4] Sheree Yau, Federico M Lauro, Matthew Z DeMaere, Mark V Brown,Torsten Thomas, Mark J Raftery, Cynthia Andrews-Pfannkoch, MatthewLewis, Jeffrey M Hoffman, John A Gibson, and Ricardo Cavicchioli. Vi-rophage control of antarctic algal host-virus dynamics.
Proc Natl Acad SciU S A , 108(15):6163–6168, Apr 2011.45] Bernard La Scola, St´ephane Audic, Catherine Robert, Liang Jungang,Xavier de Lamballerie, Michel Drancourt, Richard Birtles, Jean-MichelClaverie, and Didier Raoult. A giant virus in amoebae.
Science ,299(5615):2033, Mar 2003.[6] Micka¨el Boyer, Natalya Yutin, Isabelle Pagnier, Lina Barrassi, GhislainFournous, Leon Espinosa, Catherine Robert, Sa¨ıd Azza, Siyang Sun,Michael G. Rossmann, Marie Suzan-Monti, Bernard La Scola, Eugene V.Koonin, and Didier Raoult. Giant Marseillevirus highlights the role ofamoebae as a melting pot in emergence of chimeric microorganisms.
ProcNatl Acad Sci U S A , 106(51):21848–21853, Dec 2009.[7] D Randy Garza and Curtis A Suttle. Large double-stranded dna viruseswhich cause the lysis of a marine heterotrophic nanoflagellate (bodo sp.)occur in natural marine viral communities.
Aquatic Microbial Ecology ,9(3):203–210, 1995.[8] Matthias G Fischer, Michael J Allen, William H Wilson, and Curtis ASuttle. Giant virus with a remarkable complement of genes infects marinezooplankton.
Proc Natl Acad Sci U S A , 107(45):19508–19513, Nov 2010.[9] Defne Arslan, Matthieu Legendre, Virginie Seltzer, Chantal Abergel, andJean-Michel Claverie. Distant Mimivirus relative with a larger genomehighlights the fundamental features of megaviridae.
Proc Natl Acad Sci US A , 108(42):17486–17491, Oct 2011.[10] Nad`ege Philippe, Matthieu Legendre, Gabriel Doutre, Yohann Cout´e,Olivier Poirot, Magali Lescot, Defne Arslan, Virginie Seltzer, LionelBertaux, Christophe Bruley, J´erome Garin, Jean-Michel Claverie, andChantal Abergel. Pandoraviruses: amoeba viruses with genomes up to2.5 Mb reaching that of parasitic eukaryotes.
Science , 341(6143):281–286,Jul 2013.[11] Rafael K. Campos, Paulo V. Boratto, Felipe L. Assis, Eric R G R. Aguiar,Lorena C F. Silva, Jonas D. Albarnaz, Fabio P. Dornas, Giliane S. Trindade,Paulo P. Ferreira, Jo˜ao T. Marques, Catherine Robert, Didier Raoult,Erna G. Kroon, Bernard La Scola, and Jˆonatas S. Abrah˜ao. Samba virus:a novel mimivirus from a giant rain forest, the brazilian amazon.
Virol J ,11:95, 2014.[12] Elodie Ghedin and Jean-Michel Claverie. Mimivirus relatives in the Sar-gasso sea.
Virol J , 2:62, 2005.[13] J Craig Venter, Karin Remington, John F. Heidelberg, Aaron L. Halpern,Doug Rusch, Jonathan A. Eisen, Dongying Wu, Ian Paulsen, Karen E.Nelson, William Nelson, Derrick E. Fouts, Samuel Levy, Anthony H. Knap,Michael W. Lomas, Ken Nealson, Owen White, Jeremy Peterson, Jeff Hoff-man, Rachel Parsons, Holly Baden-Tillson, Cynthia Pfannkoch, Yu-Hui5ogers, and Hamilton O. Smith. Environmental genome shotgun sequenc-ing of the Sargasso Sea.
Science , 304(5667):66–74, Apr 2004.[14] A. S. Pandit, M. N. Joshi, P. Bhargava, G. N. Ayachit, I. M. Shaikh, Z. M.Saiyed, A. K. Saxena, and S. B. Bagatharia. Metagenomes from the salinedesert of Kutch.
Genome Announc , 2(3), 2014.[15] Rasko Leinonen, Hideaki Sugawara, Martin Shumway, and InternationalNucleotide Sequence Database Collaboration . The sequence read archive.
Nucleic Acids Res , 39(Database issue):D19–D21, Jan 2011.[16] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. Basiclocal alignment search tool.
J Mol Biol , 215(3):403–410, Oct 1990.[17] Z. Zhang, S. Schwartz, L. Wagner, and W. Miller. A greedy algorithm foraligning dna sequences.
J Comput Biol , 7(1-2):203–214, 2000.[18] Aleksandr Morgulis, George Coulouris, Yan Raytselis, Thomas L. Madden,Richa Agarwala, and Alejandro A. Sch¨affer. Database indexing for produc-tion megablast searches.