Molecular characterization based on chloroplast (trnl-f) DNA sequence of the apple genotypes in Ardahan/Turkey

Abstract

Genetic diversity among Turkish apple genotypes in Ardahan province was conducted based on cpDNA trnL-F sequences. Apple genotypes were plotted on a phylogenetic tree where Pyrus x bretschneideri was used as the outgroup. The plant samples were collected from different locations and genomic DNA was isolated from healthy and green leaves. For sequence in trnL-F region trnLe and trnFf primers were used. Later obtained DNA sequences were edited using the BioEdit and FinchTV. Sequencing data were analyzed using MEGA 6.0 software. Neighbor joining and bootstrap trees were constructed in order to verify the relationships among the apple genotypes. Phylogenetic tree consisted of two clades. The divergence values of trnL-F sequences differed between 0.000 and 0.005. Average nucleotide composition was 38.3 T, 14.9 C, 31.9 A and 14.9% G. The phylogenetic tree constructed based on trnL-F region sequences was nearly parallel to prior phylogenetic studies on apple genotypes. Introduction Anatolia is accepted as the homeland of many wild, wild edible and cultivated fruit species in addition to harboring rich apple genetic resources including mostly historical cultivars selected by humans among wild populations for centuries (Çelik et al. 2018). Apple (Malus L.) belongs to Rosaceae is a widespread genus in the world with many species (Dziubiak 2004, Ercisli 2004). Four origin centers for apples were reported, including East Asia, Central Asia, East Asia-Europe and North America. Turkey belongs to East Asia-Europe origin center and has considerable diversity (Uzun et al. 2016). Apple can easily grow in many places due to the wide area and the climate tolerance (Bulantekin and Kuşcu 2017) and a good source of phenolic compounds and antioxidants for human diet and health (Wolfe et al. 2003, Wolfe and Liu 2003). The preference criteria that consumers pay the greatest attention are its bright and red colour. Under the light of previous studies, it was detected that red vegetables and fruits have more antioxidants compared to green ones. It was also detected that in addition to having more antioxidants, red fruits also have more phenolic compounds (Neill et al. 2002a,b, Neill and Gould 2003, Hughes et al. 2005, Shao et al. 2007). Genetic markers give an insight in the amount and distribution of genetic variation within populations (Bolovic et al. 2013). By using DNA sequence data, differences and the genetic relationships of living things have been reported through the latest developments in molecular biology (Weiguo et al. 2005). Chloroplast DNA (cpDNA) sequence variations have been widely utilized for detecting species relationships between angiosperms and other plants. Hence, it has been widely used in phylogenetic assessments. Low rate of change of these molecules is restrictive in in-species degree (Taberlat et al. 1991, Türktaş et al. 2012). Chloroplast DNA (cpDNA) has many useful noncoding regions in terms of phylogenetics. Due to its phylogenetic *Author for correspondence: <[email protected]>. Food Engineering Department, Ardahan University, Ardahan, Turkey. 1100 SEVINDIK et al. value, the region of tRNA (trnT trnF) has been extensively studied. Its intergenic space takes place between trnL (UAA) 3’exon and trnF (GAA) gene (Taberlat et al. 1991, Gielly and Taberlat 1994, Gielly and Taberlat 1996, Liu et al. 2005). There are two protected exon areas in trnL gene (Fig. 1).The aim of this study was to conduct molecular characterization of local apple cultivars, which are distributed in the ecological conditions of Ardahan, through the use of trnL-F region in chloroplast DNA. Fig. 1. cpDNAtrnL-F region (Pirie et.al. 2007). Materials and Methods Apple genotypes used in the study were collected from certain regions in Ardahan/Turkey between July and August, 2015 (Fig. 2). Total genomic DNA samples were extracted using DNA Plant Kit (Gene Mark). The genomic DNA samples were stored at –20 °C. Fig. 2. Location of the Ardahan province. The upper map shows the location of Ardahan within Turkey while the enlarged region of Ardahan is shown in the lower map. The maps were obtained from Google Maps (maps.google.com). Double-stranded DNA of the complete trnL-F regions in each genomic DNA sample were amplified. Amplification of the whole trnL-F molecular marker analyzed in this study belongs to the cpDNA. PCR amplifications of trnL-F cpDNA were performed using the primers designed by Taberlet et al. (1991) (Table 1) for all taxa included in this work. The amplification process was carried out in 25 μl of PCR reaction volume. Each PCR reaction contained 2.0 μl of total genomic DNA, 15 μl of dd H2O, 5 μl master mix (PCR buffer, MgCl2, dNTP, Taq DNA polymerase), 1 μl for trnLe and 1 μl for trnFf primers and 1 μl of DMSO. Table 2 shows trnL-F PCR cycles with their respective conditions. Gel electrophoresis in 0.8% agarose gel run in 1.0X TBE (Tris-Boric EDTA) buffer was used to size fraction at amplicons. Subsequently gels were stained with ethidium bromide and visualized over a UV trans-illuminator. The trnLe and trnFf primers were MOLECULAR CHARACTERIZATION BASED ON CHLOROPLAST 1101 used both for amplification and for sequencing which were conducted at Labbiotek (İzmir, Turkey) using an ABI3130XL genetic analyzer. For each sample, forward and reverse sequencing reactions were performed and the sequences were analyzed via GenBank (NCBI) through BLASTn search. Subsequently obtained DNA sequences were edited both manually and by using BioEdit (Hall 1999), and FinchTV programs. Table 1. cpDNA trnL-F primers used in this study with their designers. Primer name 5’ to 3’ primer sequence Based on (the source publication) Forward trnLe GGTTCAAGTCCCTCTATCCC Taberlet et al. 1991 Reverse trnFf ATTTGAACTGGTGACACGAG Taberlet et al. 1991 Table 2. Cycles and conditions of trnL-F -PCR reactions. Pre-heating 94°C 5 min 1 cycle 1. step 94°C 30 s 2. step 50°C 30 s 3. step 72°C 90 s 35 cycles 4. step 72°C 8 min 1 cycle 5. step 4°C 20 min cpDNA trnL-F sequences were aligned using ClustalW alignment software (Thompson et al. 1994). The phylogenetic tree was generated using the Neighbor joining tree (Saitou and Nei 1987) and constructed using MEGA 6.0 software (Tamura et al. 2013). The phylogenetic tree was evaluated with bootstrap test with 1000 resamplings (Felsenstein 1985). Beside Pyrus × bretschneideri (GenBank: JX122456.1) taxa was used out group in the tree obtained from NCBI. Results and Discussion trnL-F sequences ranged from 418 to 428 nucleotides among 13 genotypes (only apple genotypes and except for outgroup Pyrus × bretschneideri). The highest number of nucleotides for the trnL-F sequence was observed in Uruset apple and Kırmızı Safran (428 bases) while the lowest number of nucleotides for the trnL-F sequence was observed in Sobe apple (418 bases). Average nucleotide composition of trnL-F was 38.3 T, 14.9 C, 31.9 A and 14.9% G. The maximum GC content (30.2%) and the lowest AT content (69.9%) were observed in Kırmızı Safran and Uruset apple while the lowest GC content (29.3%) and the highest AT content (70.7%) were recorded in Limon apple (Table 3). Genetic distance method based on trnL-F set was performed with MEGA 6.0 software. The lowest distance was 0.000 while the highest distance was 0.005 (Table 4). Neighbor joining tree was construted using trnL-F sequences of apple genotypes distributed in Ardahan province, and sequences of outgroup was retrieved from NCBI (GenBank). Neighbor joining tree generated based on trnL-F sequences of the samples consists of two large clades. Clade 1 consists of Sisli Uruset, Sobe apple, Sarı Safran, Paşa apple, Şah apple, Uruset apple, Kırmızı safran, Karpuz apple, and Limon apple genotypes. (Fig. 3). Sevindik et al. (2018) reported the genetic diversity of Ardahan apple genotypes using ISSR markers. In their study, Sobe apple, Kırmızı safran, Limon apple, Uruset apple, Şah apple and Sisli uruset apple genotypes were found to be in the same clade. Uzun et al. (2016) studied the genetic relationships of Turkish apple genotypes using ISSR markers. In their study, Karanfil apple, Şah apple and Paşa apple genotypes were found to be in the same group, while Kaba apple was found in a different group. In the present 1102 SEVINDIK et al. study, these two genotypes (Şah apple and Paşa apple) were found in the clade 1, while Kaba apple and Karanfil apple were found in clade 2. Osmanoğlu (2008) revealed genetic relationships of apple genotypes collected from Ardahan/Posof region using RAPD markers. As a result of their study, Sobe apple, Sarı Safran, Kırmızı safran, Uruset apple, Kaba uruset and Paşa apple genotypes were grouped in the same clade, but Limon apple genotype was in a different clade. In clade 2 consist of Table 3. Length and A+T and G+C contents of cpDNA trnL-F sequences of apple genotypes. Genotypes cpDNA trnL-F (bp) A (%)