miRNA-133a has anti-tumor effects on glioblastoma

Abstract

Introduction Glioma is a type of tumor arising from glial cells in the brain or spine, whose most common site is the brain [1]. Glioma constitutes approximately 30% of central nervous system tumors and 80% of malignant brain tumors [2]. While glioblastomas (GBMs) begins from normal brain cells or develops from an existing low-grade astrocytoma [3], it represents 15% of brain tumors [4], thus predominantly threatening patients’ life [5]. About 3/100,000 people develop GBM each year [6]. Glioblastoma is characterized by genetic instability, intra-tumoral histopathological variability and unpredictable survival probability in patients [7, 8]. The clinical hallmarks of GBM are aggressive proliferation and persistent recurrence due Li Zhao, Xian An, Wenhong Yang, Xu Han 2 Arch Med Sci to invasive infiltration [9, 10]. Despite maximum treatment, GBM frequently recurs [6]. After GBM diagnosis, in patients without treatment overall survival (OS) is typically 3 months [11], while in patients with treatment 5-year OS occurs in less than 3–5% people and 12–15-month OS is most common [6, 12]. Typically treatment of GBM involves surgery after chemotherapy (temozolomide) and radiation therapy [6]. However, there are no effective methods to anticipate GBM. PI3K/Akt and Ras-ERK pathways are aberrantly activated pathways in GBM. For instance, the activated Raf-MEK-ERK pathway was reported to enhance activity of GBM cells [13]. PI3K and ERK inhibitors were discovered to effectively treat GBM patients [14]. PI3K/Akt inhibitors were recently reported to be therapeutic options for GBM [15, 16]. microRNAs (miRNAs) lower gene expression through binding to target sites in 3′-UTR of mRNAs, and play critical roles in cancer progression and treatment [17, 18]. miR-133 was first experimentally characterized in mice [19]. In the human genome, miR-133a1, miR-133a2 and miR-133b genes were found on chromosomes 18, 20 and 6, respectively, and a mature sequence was excised from the hairpin 3′ arm. miR-133a down-regulation led to an augmentation of contraction and bronchial smooth muscles (BSM) hyperresponsiveness [20, 21]. Whether miR-133a plays a role in GBM was unknown; the current study aimed to investigate its corresponding effects. Material and methods Specimens The present study was approved by the Ethics Committee of Jining No. 1 People’s Hospital. A total of 45 cases of glioma tissues as well as 20 cases of normal brain tissues were collected at Jining No. 1 People’s Hospital from 2014 to 2016. All patients signed informed consent. We evaluated the pathology of healthy and glioma tissues by HE staining and estimated the MEK protein expression of healthy and glioma tissues by immunohistochemistry (IHC). IHC determined: 3 points: cells dyed dark brown were strongly positive; 2 points: brown yellow is masculine; 1 point: Light yellow is weak positive and 0 point: No staining is negative. Cell culture Human glioma cell line U87 was purchased from American Type Culture Collection (ATCC, USA). Cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS), 1% penicillin and streptomycin combination at 37°C in a humidified atmosphere with 5% CO2 . Cell transfection Transfection was performed using Lipofectamine 2000 transfection reagent (Invitrogen, USA) following the manufacturer’s instructions. MiR-133a mimic (miR-133a) was transfected into U87 cells with or without FGF1 agonist (GenScript (Nanjing) Co., Ltd., Nanjing, China) treatment at a concentration of 20 μM. MiR-negative control (miR-NC) was used as the negative control (NC). At the same time, U87 cells were treated with FGF1 inhibitor (Z02786-50, GenScript (Nanjing) Co., Ltd., Nanjing, China) alone as the FGF1 inhibitor (K1040, GenScript (Nanjing) Co., Ltd., Nanjing, China) treatment group. Forty-eight h after transfection, the U87 cells were used for the following experiments. The miR-133a was purchased from GenScript (Nanjing) Co., Ltd., Nanjing, China (5′-UUUGGUCCCCUUCAACCAG CUG-3′). MTT assay To examine the cell proliferation, MTT assay was performed. 24 h after transfection, log-phase human glioma U87 cells were seeded into a 96well plate (5 × 10) and cultured for 24 h. Then, 20 μl of MTT (5 mg/ml, Sigma, USA) was added. After incubation at 37°C for 4 h, 150 μl of DMSO was added. 10 min after incubation at room temperature, the optical density (OD) at 490 nm was examined using a spectrophotometer. Each experiment was repeated three times. Transwell invasion experiment The transwell migration assay was conducted with a Corning Inc. transwell chamber. In the migration assay, 2 × 104 cells suspended in 100 μl serum-free DMEM were seeded in the upper compartment of the chamber and 800 μl DMEM with 10% FBS were added to the lower compartment of the chamber. The cell of difference groups were treated by difference treatments at the same time and the cells were incubated for another 24 h. After that, the cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet. The non-migrating cells in the upper chamber were removed carefully using a cotton swab. The invasion cells were cells on the lower surface were photographed with an Olympus IX70 inverted microscope in five randomly selected visual fields and the migrated cells were uantified using Image-Pro Plus 6.0 software. Each assay was performed at least three times. Wound healing assay For cell migratory capacity detection, wound healing assay was performed. 24 h after transfection, U87 cells (10 cells/hole) were seeded in miRNA-133a has anti-tumor effects on glioblastoma Arch Med Sci 3 a 6-well plate and incubated to 100% confluence under normal cell culture conditions with 5% CO 2 at 37°C. Then, wounds were formed by using a sterile pin. Then, cells were cultured in media without serum for 48 h, and observed under an inverted microscope (Olympus, Japan). The width of wounds was measured at 0 h and 48 h. Apoptosis analysis assay For detection of cell apoptosis levels, a FITC apoptosis detection kit (Vazyme, US) was used according to the manufacturer’s instruction. 24 h after transfection, U87 cells were washed with cold PBS solution. Then, U87 cells were re-suspended in 1× binding buffer solution with Annexin V-FITC and propidium iodide (PI) and incubated for 15 min at room temperature without light. Flow cytometry (FCM) (Becton Dickinson, New Jersey, USA) was used for detection of the apoptotic rate. Tests were performed in triplicate. Cell cycle analysis Cells were collected using 0.25% trypsin, then fixed in 70% ethanol at 4°C overnight, and washed with cold PBS solution three times. Subsequently, cells were resuspended with RNase A(Sigma, USA) at 37°C for 30 min, and then cells were incubated with propidium iodide (PI) (0.05 mg/ml) at 4°C for 30 min in the dark. A FACSort flow cytometer (BD Biosciences, USA) was used for accession of the processed cells. CellQuest software (BD Biosciences, USA) was used for data analysis. RNA isolation, RT-PCR Total mRNAs and miRNAs were extracted from tissues and cells using Trizol reagent and miRNeasy mini kit (Qiagen, USA) according to the manufacturer’s protocol. For miRNA detection, reverse transcription (RT) and quantitative real-time PCR (qPCR) kits were performed. TaqMan microRNA Reverse Transcription Kit was used for RT reactions. Real-time PCR was performed using QuantiTect SYBR Green PCR kit (Qiagen, USA), according to the manufacturer’s instructions. The PCR reactions conditions were 95°C for 10 min, followed by 37 cycles at 95°C for 15 s, and 72°C for 30 s. The housekeeping gene GAPDH (for mRNA) or U6 snRNA (for miRNA) was used as an internal control. Tests were performed in triplicate. The relative expression was analyzed using the Comparative Ct method. The primers of qPCR were as shown in Table I. Western blot analysis Cells were harvested by RIPA lysis buffer and protease inhibitor cocktail (Roche). Each sample was electrophoresed on SDS-PAGE, transferred onto PVDF membrane (Millipore). After blocking with 5% BSA for 1 h at room temperature, blots were probed with corresponding primary (MEK, p-MEK, PI3K, p-PI3K, AKT, p-AKT, ERK, p-Erk and GAPDH at 1 : 1000) antibodies overnight at 4°C. HRP labeled secondary antibodies were probed for 1 h at room temperature. GAPDH (Sigma Aldrich, 1 : 10,000) was used as a loading control. Statistical analysis Data are displayed as the mean ± SD. All statistical analyses were performed using SPSS 17.0 statistical software (SPSS, Chicago, IL, United States). T-test was used to evaluate the difference between groups. A value of p < 0.05 was considered statistically significant. Results Clinical analysis Compared with healthy tissues, the cancer cell invasion and migration of cancer tissues were increased by HE staining (Figure 1 A). IHC assay was used to evaluate the MEK protein in healthy and glioma tissues. The results showed the MEK protein in glioma tissues and healthy tissues. The ERK protein expression of glioma tissues was significantly up-regulated compared with that of healthy tissues (p < 0.05, Figure 1 B). Forty-five cases of glioma tissues and 20 cases of normal brain tissues were collected and used to investigate the expression differences of miR-133a. The results demonstrated that miR-133a in glioma tissues was greatly decreased compared with normal brain tissues (Figure 1 C). However, The MEK gene expression of glioma tissues was significantly decreased compared with healthy tissues (p < 0.05, Figure 1 D). The miR133a gene expression was negatively correlated with MEK gene expression (r = –5.5196, Figure 1 E). miR-133a is positively correlated with patients’ OS Patients were followed up for up to 32.9 months. The relationship between miR-133a level and OS was analyzed. We found that the longer the patients’ OS, the higher was the miR-133a Table I. Primer sequences for PCR Sequence (5’–3’) miR-133a: Forward:5’UUUGGUCCCCUUCAACCAGCUG3’ miR-133a: Reverse:5’UAAACCAAGGUAAAAUGGUCGA3’ MEK-Forward