Abeer Ghazal

Chlamydophila pneumoniae, Mycoplasma pneumoniae, and influenza in children with respiratory infections in Alexandria, Egypt.

INTRODUCTION Acute respiratory infections (ARI) are the leading cause of pediatric morbidity and mortality worldwide. Information about etiological agents of ARI in developing countries is still limited. METHODOLOGY Throat swabs collected from children hospitalized with ARI between December 2009 and May 2010 were investigated for Chlamydophila pneumoniae, Mycoplasma pneumoniae, and influenza viruses by molecular analyses. RESULTS This study conducted in Alexandria, Egypt, was designed to determine the prevalence of several microorganisms in 156 children hospitalized with ARI. Overall, samples from 76 individuals (49%) were found to be positive for at least one pathogen, and 10 of them were positive for two agents. C. pneumoniae was the most commonly detected agent, followed by M. pneumonia and H1N1 pandemic influenza virus. Positivity for C. pneumoniae was associated with colder months and mild disease of the upper respiratory tract such as laryngitis. CONCLUSIONS Further studies are needed to identify other possible agents of ARI (e.g., RSV, adenoviruses, other bacterial infections) in this population and to better understand the causal role of atypical bacteria detected in respiratory samples.

Community-acquired methicillin-resistant Staphylococcus aureus from skin and soft tissue infections (in a sample of Egyptian population): analysis of mec gene and staphylococcal cassette chromosome

BACKGROUND Staphylococcus aureus has been recognized as an important pathogen associated with inpatients and community infections. Community-acquired methicillin-resistant S. aureus (CA-MRSA) infections commonly present as skin and soft-tissue infections (SSTIs). Treatment often includes incision and drainage with or without adjunctive antibiotics. OBJECTIVES This study aimed to identify CA-MRSA infections both phenotypically and genotypically, to determine their spectrum of antibiotic resistance, and to establish the best scheme for molecular distinction between hospital-acquired MRSA (HA-MRSA) and CA-MRSA by staphylococcal cassette chromosome mec (SCCmec) typing and detection of Panton Valentine leukocidin (PVL). MATERIALS 50 swabs, from skin and soft tissue of infected lesions of outpatients attending the dermatology department of the Medical School, Alexandria University, were collected. Additionally, a nasal swab was taken from every participant. METHODS Collection of swabs from the infected skin and soft tissues, followed by laboratory testing to phenotypically and genotypically identify MRSA. Also, nasal swabs were taken from every patient to identify MRSA colonization. RESULTS Staphylococcus aureus strains were identified in 38 (76%) of the 50 clinical isolates. 18 (47.37%) out of the 38 S. aureus strains were resistant to oxacillin and cefoxitin discs, were penicillin binding protein 2a (PBP2a) producers, and were initially diagnosed as MRSA. All of the 18 strains were definitively diagnosed as MRSA by mecA gene detection using real time PCR, while only six (33.33%) strains were PVL positive. Using the sets of primers of Zhang et al.: nine (50%) out of the 18 CA-MRSA strains were SCCmec type V, and one (5.56%) was SCCmec type IVc. Then, using the set of primers by Oliveira et al., two (25%) out of the eight untypable MRSA strains were found to be SCCmec type IV, and six (75%) remained untypable. CONCLUSIONS CA-MRSA must be considered when treating skin and soft tissue infections, especially in developing countries. Empirical use of agents active against CA-MRSA is warranted for patients presenting with serious SSTIs.

Association of some virulence genes with antibiotic resistance among uropathogenic Escherichia coli isolated from urinary tract infection patients in Alexandria, Egypt: A hospital-based study

Uropathogenic Escherichia coli (UPEC) is the infecting agent most frequently involved in urinary tract infections (UTIs) worldwide. UPEC resistance to commonly used antibiotics represents a major health problem all over the world. Several factors have been associated with UPEC resistance to antibiotics. The present study deployed a molecular approach to explore the association between some UPEC virulence genes and antibiotic resistance among patients with UTI in Alexandria, Egypt. The study revealed a significant association between presence of the pap gene and resistance to gentamicin; however, it was not significantly associated with resistance to β-lactam antibiotics, quinolones, aminoglycosides, nitrofurantoin and trimethoprim/sulfamethoxazole. The genes sfa, aer and cnf1 were not significantly associated with UPEC resistance to any of the tested antibiotics. In conclusion, resistance of UPEC isolates in the present study could be attributed to other virulence factors.

Detection and correlates of Chlamydophila pneumoniae among children with acute respiratory infections

Acute respiratory infections (ARI) are the leading cause of pediatric morbidity and mortality worldwide. Information on etiological agents of ARI in developing countries is still limited. This study conducted in Alexandria, Egypt, was designed to determine the prevalence of several microorganisms in 113 children hospitalized with ARI. Overall, 65 agents were identified; 58 (51.3%) individuals were found to be positive for at least one pathogen, and seven of them were also positive for two agents. Chlamydophila pneumoniae was the most commonly detected agent (n = 32; 28.3%), followed by Mycoplasma pneumoniae, respiratory syncytial and influenza. Positivity for C. pneumoniae, which was the most commonly detected agent, was associated with male sex and with mild disease of the upper respiratory tract.

Arboviral infections in Egyptian and Sardinian children and adults with aseptic meningitis and meningo-encephalitis

Dear Sir, Arboviruses belonging to the Phlebovirus genus are a possible cause of central nervous system (CNS) infection during the summer months in several Mediterranean countries. In particular, Toscana virus (TOSV) has been detected in individuals, appearing firstly in continental Italy, and then in Spain and the south of France [1]. In order to better define the impact and geographical range of TOSV infection, we conducted a study in Egypt and on the Mediterranean island of Sardinia. We also looked for Flavivirus infection among Egyptian patients. Overall, 79 cerebrospinal fluid (CSF) samples were collected from patients presenting with acute aseptic meningitis or meningo-encephalitis of suspected viral origin occurring in the hot season (i.e., between May and November). Of these patients, 42 were recruited by the Paediatric University Hospital and Fever Hospital of Alexandria, Egypt, and 37 by the Infectious Diseases Unit of the University Hospital of Sassari. Of the cases recruited in Sassari, 28 had been included in a previously published phylogenetic study [2]. Demographic and clinical information was collected for each of the study participants (Table I). To detect TOSV IgM antibodies, a m-capture enzyme-linked immunosorbent assay (ELISA) was performed as previously described [3]. The presence of IgM antibodies was assumed to indicate a recent TOSV infection. IgM-positive samples were confirmed by a plaque reduction neutralization test (PRNT). To identify TOSV and Flavivirus sequences in the CSF, viral RNA was extracted using a QIAamp viral RNA kit (Qiagen, Hilden, Germany) from 140 ml of the patient’s CSF sample, following the manufacturer’s instructions. For the amplification of TOSVspecific sequences, reverse transcriptase polymerase chain reaction (RT-PCR) and nested PCR were performed using primer pairs TosN123 TosN829 and TosN234 TosN794 as described by SanchezSeco et al. [4]. For the amplification of different members of the Japanese encephalitis group of the Flaviviridae family, primers from genomic conserved regions were chosen from the literature [5,6], and arranged in a semi-nested configuration. RT-PCR was performed with the primer pair MAMD (5?aacatgatgggraaragrgaraa3?)/MF4 (5?gggg tctcctctaacctctagtcctt3?), with the following cycling

Detection of occult hepatitis B virus among chronic hepatitis C patients

Abstract Background Concurrent infections with hepatitis B virus (HBV) and hepatitis C virus (HCV) are increasingly recognized in patients with chronic hepatitis. In Egypt, the last decade showed a remarkable decline in HBV infection associated with remarkable rise in HCV infection. The probable impact of occult HBV in patients with chronic HCV infection has been previously investigated and the evidence suggests a possible correlation with lower response to anti-viral treatment, higher grades of liver histological changes, and development of hepatocellular carcinoma. The aim of this study was to analyze the possible influence of occult HBV infection on the clinical outcomes in chronic HCV patients and to compare conventional and real-time PCR in detecting HBV DNA among Hepatitis B surface antigen (HBsAg) negative chronic HCV. Methods Sera collected from 100 chronic HCV patients (negative for HBsAg and positive for anti-HCV and HCV RNA) were tested for anti-HBc, anti-HBe and anti-HBs by ELISA, HCV-RNA viral load was determined by real-time PCR (TaqMan probe technique) and HBV DNA was detected with primers encoding the surface (S), core (C), polymerase (pol) and X genes. In addition, determination of liver enzymes including aspartate and alanine aminotransferases (AST, ALT) activities was performed. Results Fifty-eight percent of the study group were positive for anti-HBc. Meanwhile, only 18 cases (18%) were positive for the polymerase gene by nested PCR and were considered as occult HBV. Among these 18 polymerase gene positive patients (occult HBV) anti-HBc was detected among 9 (50%) of cases. Different gene profiles were noticed among the 18 polymerase gene positive patients.

Angiogenic output in viral hepatitis, C and B, and HCV-associated hepatocellular carcinoma

Abstract Introduction Angiogenesis is known to play a pivotal role in most of malignancy, including HCC, and in chronic inflammation. Aim To investigate the angiogenic output in HCV and HBV infection and its implication in the development of HCV associated HCC. Materials and methods Blood samples were collected and grouped as; HS healthy subjects control group; HCC–HCV; chronic HCV infected patient group (HCV+ve) who are positive for serum anti-HCV antibodies and HCV–RNA; anti-HCV antibody positive and HCV–RNA negative patient group (HCV−ve); patients with positive HBsAg and HBV-DNA group (HBV+ve); and HBsAg positive and HBV-DNA negative patient group (HBV−ve). Serum levels of vascular endothelial growth factor, angiopoietin-2, endostatin and angiostatin were assessed in different studied groups. Results The level of sVEGF was insignificantly elevated in both HCV+ve and HCV−ve groups when compared with controls, while Ang-2, sES and sAS were significantly elevated in both groups as compared with healthy controls. The studied parameters were significantly elevated in HBV-+ve patients when compared with the control. However, HBV−ve patients showed significantly elevated levels in sAng-2, sES and sAS when compared with the control while the level of sVEGF was equal to that of controls. In patients with HCC, the studied parameters showed a significant elevation when compared with healthy controls and patients either with HBV or HCV infection except for sAS in the case of HCV-+ve patients and VEGF for HBV-+ve patients who were also higher but not significant. Conclusion The increased hepatic angiogenesis in chronic HCV and HBV could provide the molecular basis for liver carcinogenesis and contribute to the increased risk of HCC in patients with cirrhosis due to HCV and/or HBV.