Agnieszka Pszczółkowska

Plant lignans inhibit growth and trichothecene biosynthesis in Fusarium graminearum

Lignans are a group of diphenolic compounds with anticancer and antioxidant properties which are present in various grains, although their effect on toxigenic fungi has been poorly examined to date. In this study, the impact of the plant lignans pinoresinol and secoisolariciresinol on growth and trichothecene biosynthesis by five Fusarium graminearum strains of different chemotypes was examined in vitro. Both tested lignans exhibited radial growth inhibition against the fungal strains. RT‐qPCR analyses of tri4, tri5 and tri11 genes encoding the first steps of the trichothecene biosynthesis pathway revealed a decrease in tri mRNA levels in lignan‐treated fungal cultures. Correspondingly, decreased accumulation of toxins in lignan‐treated cultures was confirmed by GC‐MS analysis. This is the first study to demonstrate the inhibitory effect of both pinoresinol and secoisolariciresinol on growth and trichothecene biosynthesis in F. graminearum.

Multilocus Phylogenetics Show High Intraspecific Variability within Fusarium avenaceum

Fusarium avenaceum is a common soil saprophyte and plant pathogen of a variety of hosts worldwide. This pathogen is often involved in the crown rot and head blight of cereals that affects grain yield and quality. F. avenaceum contaminates grain with enniatins more than any species, and they are often detected at the highest prevalence among fusarial toxins in certain geographic areas. We studied intraspecific variability of F. avenaceum based on partial sequences of elongation factor-1 alpha, enniatin synthase, intergenic spacer of rDNA, arylamine N-acetyltransferase and RNA polymerase II data sets. The phylogenetic analyses incorporated a collection of 63 F. avenaceum isolates of various origin among which 41 were associated with wheat. Analyses of the multilocus sequence (MLS) data indicated a high level of genetic variation within the isolates studied with no significant linkage disequilibrium. Correspondingly, maximum parsimony analyses of both MLS and individual data sets showed lack of clear phylogenetic structure within F. avenaceum in relation to host (wheat) and geographic origin. Lack of host specialization indicates no host selective pressure in driving F. avenaceum evolution, while no geographic lineage structure indicates widespread distribution of genotypes that resulted in nullifying the effects of geographic isolation on the evolution of this species. Moreover, significant incongruence between all individual tree topologies and little clonality is consistent with frequent recombination within F. avenaceum.

MULTILOCUS SEQUENCE ANALYSIS OF FUSARIUM POAE

SUMMARY Emerging prevalence of F. poae in fungal biota of small-grain cereals has been documented in many diverse geographic areas. We studied the phylogenetic relationships among 40 F. poae isolates from different geographic origins and hosts based on partial sequences of elongation factor-1 alpha (ef1), enniatin synthase (esyn1), intergenic spacer of rDNA (igs), RNA polymerase II (rpb2) and trichodiene synthase (tri5) data sets. Sequence alignments of five individual data sets showed low genetic variability within F. poae with limited development of clonal lineages. Evolutionary divergence varied between genes, with high phylogenetic incongruence between ef1, igs, rpb2 and genes involved in secondary metabolism (esyn1 and tri5). MLS (multilocus sequence analysis) bootstrap consensus tree inferred from the MP separated all 40 F. poae isolates into four well-supported subgroups, although there was no clear geographic or host type basis on this separation. Lack of correlation between subgroups of any individual data set and geographic origin of the isolates and host (wheat) suggests absence of geographic isolation between local populations of F. poae and high adaptative potential of this species to changing environmental conditions, hosts or substrates. The results of the present study may also suggest that recently reported emerging prevalence of F. poae in grain mycobiota is not associated with dramatic changes in the population structure of F. poae.

Current possibilities and prospects of using fungicides in forestry

Abstract The possibility of using chemicals in European forestry is extremely limited due to the binding legal regulations and specific conditions concerning the market of plant protection products. This is reflected in the limited availability of active fungicides in forestry. Due to this limitation, practitioners using fungicides in forest nurseries and forest cultivation must have substantial knowledge of the biology of pathogens to ensure satisfactorily effective protection. The work presented here provides an overview of the currently recommended fungicides in Polish forestry as well as the mechanisms of interaction between the active substances and the pathogen, the plant and mycorrhizal fungi. The risk of fungicide resistance, which has been insufficiently explored in the context of forest pathogens, is also discussed in this paper.

First Report of Fagus sylvatica Infection by Fusarium avenaceum in Forest Container Nurseries in Northeastern Poland

Container nurseries in northeastern Poland annually provide several million tree seedlings used for afforestation of post-agricultural soils and restocking of forests. Beech (Fagus sylvatica), one of the main forest tree species in Poland, is largely applied in this process. We have observed in container nurseries of young beech saplings in Poland symptoms of wilting and damping off. The average rate of damage in container cultures was 21 to 31%, including those beech seedlings (5 to 7%) that eventually succumbed. The infected leaves, stems, and roots were washed in distilled water and then disinfected with 70% ethanol and 1% sodium hypochlorite. The plates with plant material were incubated at 22°C for approximately 7 days. A total of 14 single-spore fungal cultures isolated from infected beech seedlings were identified, based on morphological features, as F. avenaceum (1,2). PDA colonies consisted of flat, aerial mycelium that was white to rose, with rose to carmine pigment on the reverse surface, with small black sclerotial bodies. Microconidia were cylindrical with one to four septa, predominantly 10 to 25 μm long. Macroconidia were hyaline, straight to slightly curved, four- to six-septate (generally 50 to 65 × 4 to 4.5 μm). All isolates were deposited in the Department of Plant Diagnostics and Pathophysiology Fungal Culture Collection (Accession Nos. FL.Ol.35.13-42.13) (University of Warmia and Mazury in Olsztyn, Poland) and are stored in 15% glycerol at -80°C. DNA from the fungal cultures was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete of EF1α gene sequence was amplified with the primers avef11 (CGACTCTGGCAAGTCGACCA) and avef12 (TACCAATGACGGTGACATAG) and sequenced. A single sequence from isolate FL.Ol.35.13, which was used in the beech infection study (Gen Bank Accession No. KM985475), was obtained. It had the length of 411 bp and was 100% identical to sequences of several isolates of F. avenaceum at GenBank (HQ704072.1, EF512014.1, and HQ704073). To verify pathogenicity of the fungus, a controlled infection was carried out with spores of isolate FL.Ol.35.13. The spores were used at the density of 2 × 105/ml. Seeds of beech were sown to sterile perlite, and after cotyledon emergence they were watered with F. avenaceum spore suspension (5 ml/plant). Control plants were treated with water only. After 30 days, the rate of disease was estimated. Severely infected seedlings showed typical symptoms of damping-off and Fusarium wilt, while in less-affected seedlings, zonated spots with F. avenaceum sporodochia could be seen on cotyledons. No infection symptoms were seen on control seedlings. Fungal cultures were started from plants subjected to controlled infection, and, based on morphological features, the fungus was identified again as F. avenaceum. To our knowledge this is the first report of Fusarium (F. avenaceum) disease of beech in container nurseries in Poland. References: (1) W. Gerlach and H. I. Nirenberg. Mitt. Biol. Bundesanst. Land- Forstwirsch., Berlin-Dahlem 209:1, 1982. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Professional, Ames, IA, 2006.

The complete chloroplast genome of Colobanthus apetalus (Labill.) Druce: genome organization and comparison with related species

Colobanthus apetalus is a member of the genus Colobanthus, one of the 86 genera of the large family Caryophyllaceae which groups annual and perennial herbs (rarely shrubs) that are widely distributed around the globe, mainly in the Holarctic. The genus Colobanthus consists of 25 species, including Colobanthus quitensis, an extremophile plant native to the maritime Antarctic. Complete chloroplast (cp) genomes are useful for phylogenetic studies and species identification. In this study, next-generation sequencing (NGS) was used to identify the cp genome of C. apetalus. The complete cp genome of C. apetalus has the length of 151,228 bp, 36.65% GC content, and a quadripartite structure with a large single copy (LSC) of 83,380 bp and a small single copy (SSC) of 17,206 bp separated by inverted repeats (IRs) of 25,321 bp. The cp genome contains 131 genes, including 112 unique genes and 19 genes which are duplicated in the IRs. The group of 112 unique genes features 73 protein-coding genes, 30 tRNA genes, four rRNA genes and five conserved chloroplast open reading frames (ORFs). A total of 12 forward repeats, 10 palindromic repeats, five reverse repeats and three complementary repeats were detected. In addition, a simple sequence repeat (SSR) analysis revealed 41 (mono-, di-, tri-, tetra-, penta- and hexanucleotide) SSRs, most of which were AT-rich. A detailed comparison of C. apetalus and C. quitensis cp genomes revealed identical gene content and order. A phylogenetic tree was built based on the sequences of 76 protein-coding genes that are shared by the eleven sequenced representatives of Caryophyllaceae and C. apetalus, and it revealed that C. apetalus and C. quitensis form a clade that is closely related to Silene species and Agrostemma githago. Moreover, the genus Silene appeared as a polymorphic taxon. The results of this study expand our knowledge about the evolution and molecular biology of Caryophyllaceae.

The complete mitogenome of Colletotrichum lupini var. setosum

Abstract The structure of Colletotrichum lupini mitogenome is typical of a fungus from the genus Colletotrichum similar to C. acutatum and C. lindemuthianum. The sequenced mitogenome has a total length of 36 554 bp. The nucleotide composition in the following genome is: 35.7% – A, 16.5% – C, 13.4% – G and 29.9% – T. In the C. lupini mitogenome we identified 46 genes: 15 protein coding genes, two ribosomal RNAs and 29 tRNA genes.

The complete mitogenome of Mycosphaerella pinodes (Ascomycota, Mycosphaerellaceae)

Abstract In this study, the complete mitochondrial genome of plant pathogenic fungus, Mycosphaerella pinodes, was sequenced. The nucleotide composition of the genome is: 36.0% of A, 15.0% of C, 14.6% of G and 34.5% of T. The mitochondrial genome is 55 973 bp in length and consists of 11 protein-coding genes, two ribosomal RNAs and 25 tRNA genes. The mitogenome analysis of M. pinodes provide a molecular basis for further studies on molecular systematics and evolutionary dynamics of Ascomycetes fungi especially belonging to Dothideomycetes.

Fungi colonising oak seedlings (Quercus robur L.) in forest plantations in north-eastern Poland

Abstract Fungi colonising oak seedlings in forest plantations in north-eastern Poland were identified in 2014-2015. The evaluated 4- to 6-year bare root oaks originated from the Olsztynek Forest District (Regional Directorate of the State Forests in Olsztyn). In total, 744 fungal isolates belonging to 11 different species, and 11 genera, were identified in tested plants. Amongst them, 186 cultures (25%) were classified as plant pathogens. The most commonly isolated pathogenic fungi belonged to the Fusarium and Cylindrocarpon genera.

The possibilities of biologically protecting plants against diseases in nurseries, with special consideration of Oomycetes and Fusarium fungi

Abstract Achieving high quality propagative material is difficult today due to the limited number of pesticides recommended for use. Simultaneously, EU regulations on Integrated Pest Management (IPM) in forest nurseries came into a force, requiring a search for alternative plant protection methods that are safe for humans, animals and the environment. In this paper, we present the possibilities of using bio-fungicides against diseases in forest nurseries, their mechanisms of action, as well as the direction of their development (according to IPM rules). We reviewed the results achieved by different research teams presenting the possibilities and trends in combatting Oomycetes and Fusarium spp. pathogens currently having the most important economic impact.