Alan H. Beggs

Mutations in ACTN4, encoding α-actinin-4, cause familial focal segmental glomerulosclerosis

Focal and segmental glomerulosclerosis (FSGS) is a common, non-specific renal lesion. Although it is often secondary to other disorders, including HIV infection, obesity, hypertension and diabetes, FSGS also appears as an isolated, idiopathic condition. FSGS is characterized by increased urinary protein excretion and decreasing kidney function. Often, renal insufficiency in affected patients progresses to end-stage renal failure, a highly morbid state requiring either dialysis therapy or kidney transplantation. Here we present evidence implicating mutations in the gene encoding α-actinin-4 (ACTN4; ref. 2), an actin-filament crosslinking protein, as the cause of disease in three families with an autosomal dominant form of FSGS. In vitro, mutant α-actinin-4 binds filamentous actin (F-actin) more strongly than does wild-type α-actinin-4. Regulation of the actin cytoskeleton of glomerular podocytes may be altered in this group of patients. Our results have implications for understanding the role of the cytoskeleton in the pathophysiology of kidney disease and may lead to a better understanding of the genetic basis of susceptibility to kidney damage.

DETECTION OF 98% OF DMD/BMD GENE DELETIONS BY POLYMERASE CHAIN REACTION

SummaryWe describe oligonucleotide primer sequences that can be used to amplify eight exons plus the muscle promoter of the dystrophin gene in a single multiplex polymerase chain reaction (PCR). When used in conjunction with an existing primer set, these two multiplex reactions detect about 98% of deletions in patients with Duchenne or Becker muscular dystrophy (DMD, BMD). Furthermore, these primers amplify most of the exons in the deletion prone “hot spot” region around exons 44 to 53, allowing determination of deletion endpoints and prediction of mutational effects on the translational reading frame. Thus, use of these PCR-based assays will allow deletion detection and prenatal diagnosis for most DMD/BMD patients in a fraction of the time required for Southern blot analysis.

Distinctive patterns of microRNA expression in primary muscular disorders

The primary muscle disorders are a diverse group of diseases caused by various defective structural proteins, abnormal signaling molecules, enzymes and proteins involved in posttranslational modifications, and other mechanisms. Although there is increasing clarification of the primary aberrant cellular processes responsible for these conditions, the decisive factors involved in the secondary pathogenic cascades are still mainly obscure. Given the emerging roles of microRNAs (miRNAs) in modulation of cellular phenotypes, we searched for miRNAs regulated during the degenerative process of muscle to gain insight into the specific regulation of genes that are disrupted in pathological muscle conditions. We describe 185 miRNAs that are up- or down-regulated in 10 major muscular disorders in humans [Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophies types 2A and 2B, Miyoshi myopathy, nemaline myopathy, polymyositis, dermatomyositis, and inclusion body myositis]. Although five miRNAs were found to be consistently regulated in almost all samples analyzed, pointing to possible involvement of a common regulatory mechanism, others were dysregulated only in one disease and not at all in the other disorders. Functional correlation between the predicted targets of these miRNAs and mRNA expression demonstrated tight posttranscriptional regulation at the mRNA level in DMD and Miyoshi myopathy. Together with direct mRNA–miRNA predicted interactions demonstrated in DMD, some of which are involved in known secondary response functions and others that are involved in muscle regeneration, these findings suggest an important role of miRNAs in specific physiological pathways underlying the disease pathology.

Mutations in dynamin 2 cause dominant centronuclear myopathy

Autosomal dominant centronuclear myopathy is a rare congenital myopathy characterized by delayed motor milestones and muscular weakness. In 11 families affected by centronuclear myopathy, we identified recurrent and de novo missense mutations in the gene dynamin 2 (DNM2, 19p13.2), which encodes a protein involved in endocytosis and membrane trafficking, actin assembly and centrosome cohesion. The transfected mutants showed reduced labeling in the centrosome, suggesting that DNM2 mutations might cause centronuclear myopathy by interfering with centrosome function.

A common nonsense mutation results in alpha-actinin-3 deficiency in the general population.

T he α-actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments 1. In humans, two genes (ACTN2 and ACTN3) encode the closely related α-actinin-2 and α-actinin-3 skeletal muscle iso-forms 2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres 3. We have previously demonstrated absence of α-actinin-3 in muscle biopsies from several patients with muscular dystrophy 3. A follow-up study identified additional α-actinin-3−negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness 4. Subsequently, we screened muscle specimens with dys-trophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a−d). Although these biopsies contained normal α-actinin-2 expression, deficiency of α-actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histo-pathological or clinical phenotype. To ascertain whether α-actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´–GATGGTTATGCAGCCCGAGG–3ánd 5´–AGCAACGCCCGCACCTCCT–3´) and AB8/AB1 (5´–TGCACGAAGCCTG-GACCC–3ánd 5´–AGAGAGGGATCTT-TATTCAG–3´), we PCR-amplified two overlapping fragments encompassing bases 24−2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of α-actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an A→G transition at nt 1,586 in exon 15, changing a gluta-mine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a C→T trans-version at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e−g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation. The R577X change creates a novel DdeI site (Fig. 1h). An additional 125 biopsies for which matched DNA samples were available were tested for α-actinin-3 expression and ACTN3 genotype (48 α-actinin-3−deficient and 77 α-actinin-3− positive biopsies with a mixture of histological and clinical …

Ribosomal Protein L5 and L11 Mutations Are Associated with Cleft Palate and Abnormal Thumbs in Diamond-Blackfan Anemia Patients

Diamond-Blackfan anemia (DBA), a congenital bone-marrow-failure syndrome, is characterized by red blood cell aplasia, macrocytic anemia, clinical heterogeneity, and increased risk of malignancy. Although anemia is the most prominent feature of DBA, the disease is also characterized by growth retardation and congenital anomalies that are present in approximately 30%-50% of patients. The disease has been associated with mutations in four ribosomal protein (RP) genes, RPS19, RPS24, RPS17, and RPL35A, in about 30% of patients. However, the genetic basis of the remaining 70% of cases is still unknown. Here, we report the second known mutation in RPS17 and probable pathogenic mutations in three more RP genes, RPL5, RPL11, and RPS7. In addition, we identified rare variants of unknown significance in three other genes, RPL36, RPS15, and RPS27A. Remarkably, careful review of the clinical data showed that mutations in RPL5 are associated with multiple physical abnormalities, including craniofacial, thumb, and heart anomalies, whereas isolated thumb malformations are predominantly present in patients carrying mutations in RPL11. We also demonstrate that mutations of RPL5, RPL11, or RPS7 in DBA cells is associated with diverse defects in the maturation of ribosomal RNAs in the large or the small ribosomal subunit production pathway, expanding the repertoire of ribosomal RNA processing defects associated with DBA.

Gene expression comparison of biopsies from Duchenne muscular dystrophy (DMD) and normal skeletal muscle

The primary cause of Duchenne muscular dystrophy (DMD) is a mutation in the dystrophin gene leading to the absence of the corresponding RNA transcript and protein. Absence of dystrophin leads to disruption of the dystrophin-associated protein complex and substantial changes in skeletal muscle pathology. Although the histological pathology of dystrophic tissue has been well documented, the underlying molecular pathways remain poorly understood. To examine the pathogenic pathways and identify new or modifying factors involved in muscular dystrophy, expression microarrays were used to compare individual gene expression profiles of skeletal muscle biopsies from 12 DMD patients and 12 unaffected control patients. Two separate statistical analysis methods were used to interpret the resulting data: t test analysis to determine the statistical significance of differential expression and geometric fold change analysis to determine the extent of differential expression. These analyses identified 105 genes that differ significantly in expression level between unaffected and DMD muscle. Many of the differentially expressed genes reflect changes in histological pathology. For instance, immune response signals and extracellular matrix genes are overexpressed in DMD muscle, an indication of the infiltration of inflammatory cells and connective tissue. Significantly more genes are overexpressed than are underexpressed in dystrophic muscle, with dystrophin underexpressed, whereas other genes encoding muscle structure and regeneration processes are overexpressed, reflecting the regenerative nature of the disease.

Ribosomal Protein S24 Gene Is Mutated in Diamond-Blackfan Anemia

Diamond-Blackfan anemia (DBA) is a rare congenital red-cell aplasia characterized by anemia, bone-marrow erythroblastopenia, and congenital anomalies and is associated with heterozygous mutations in the ribosomal protein (RP) S19 gene (RPS19) in approximately 25% of probands. We report identification of de novo nonsense and splice-site mutations in another RP, RPS24 (encoded by RPS24 [10q22-q23]) in approximately 2% of RPS19 mutation-negative probands. This finding strongly suggests that DBA is a disorder of ribosome synthesis and that mutations in other RP or associated genes that lead to disrupted ribosomal biogenesis and/or function may also cause DBA.

Mutation of the Gene for IsK Associated With Both Jervell and Lange-Nielsen and Romano-Ward Forms of Long-QT Syndrome

BACKGROUND Long-QT syndrome (LQTS) is a disorder of ventricular repolarization characterized by a prolonged QT interval, syncope, seizures, and sudden death. Recently, three forms of LQTS have been shown to result from mutations in potassium or sodium ion channel genes: KVLQT1 for LQT1, HERG for LQT2, and SCN5A for LQT3. IsK, an apparent potassium channel subunit encoded by KCNE1 on chromosome 21, regulates both KVLQT1 and HERG. This relationship makes KCNE1 a likely candidate gene, because mutations of these genes are known to cause both the autosomal dominant Romano-Ward and recessive Jervell and Lange-Nielsen (JLN) forms of LQTS. METHODS AND RESULTS We screened 84 unrelated patients with Romano-Ward and 4 with JLN for possible mutations in KCNE1. We identified one homozygous mutation in a JLN patient that results in the nonconservative substitution of Asn for Asp at amino acid 76. The patient is congenitally deaf-mute, with recurrent syncopal events and a greatly prolonged QTc interval. The probands mother and half-sister are both heterozygous for this mutation. Remarkably, both these family members have prolonged QTc intervals and would have been classified as Romano-Ward patients if not for the probands diagnosis of JLN. This mutation was not identified in more than 100 control individuals. CONCLUSIONS These data provide strong evidence that KCNE1 mutations represent a fifth LQTS locus (LQT5). Further functional analysis, as well as the identification of more LQTS patients with KCNE1 mutations, will be important to confirm the role of IsK in LQTS.

Abnormalities of the large ribosomal subunit protein, Rpl35A, in diamond-blackfan anemia

Diamond-Blackfan anemia (DBA) is an inherited bone marrow failure syndrome characterized by anemia, congenital abnormalities, and cancer predisposition. Small ribosomal subunit genes RPS19, RPS24, and RPS17 are mutated in approximately one-third of patients. We used a candidate gene strategy combining high-resolution genomic mapping and gene expression microarray in the analysis of 2 DBA patients with chromosome 3q deletions to identify RPL35A as a potential DBA gene. Sequence analysis of a cohort of DBA probands confirmed involvement RPL35A in DBA. shRNA inhibition shows that Rpl35a is essential for maturation of 28S and 5.8S rRNAs, 60S subunit biogenesis, normal proliferation, and cell survival. Analysis of pre-rRNA processing in primary DBA lymphoblastoid cell lines demonstrated similar alterations of large ribosomal subunit rRNA in both RPL35A-mutated and some RPL35A wild-type patients, suggesting additional large ribosomal subunit gene defects are likely present in some cases of DBA. These data demonstrate that alterations of large ribosomal subunit proteins cause DBA and support the hypothesis that DBA is primarily the result of altered ribosomal function. The results also establish that haploinsufficiency of large ribosomal subunit proteins contributes to bone marrow failure and potentially cancer predisposition.