Alberto Blázquez

Mitochondrial Respiration Controls Lysosomal Function during Inflammatory T Cell Responses

The endolysosomal system is critical for the maintenance of cellular homeostasis. However, how endolysosomal compartment is regulated by mitochondrial function is largely unknown. We have generated a mouse model with defective mitochondrial function in CD4(+) T lymphocytes by genetic deletion of the mitochondrial transcription factor A (Tfam). Mitochondrial respiration deficiency impairs lysosome function, promotes p62 and sphingomyelin accumulation, and disrupts endolysosomal trafficking pathways and autophagy, thus linking a primary mitochondrial dysfunction to a lysosomal storage disorder. The impaired lysosome function in Tfam-deficient cells subverts T cell differentiation toward proinflammatory subsets and exacerbates the in vivo inflammatory response. Restoration of NAD(+) levels improves lysosome function and corrects the inflammatory defects in Tfam-deficient T cells. Our results uncover a mechanism by which mitochondria regulate lysosome function to preserve T cell differentiation and effector functions, and identify strategies for intervention in mitochondrial-related diseases.

Cellular pathophysiological consequences of BCS1L mutations in mitochondrial complex III enzyme deficiency.

Mutations in BCS1L, an assembly factor that facilitates the insertion of the catalytic Rieske Iron‐Sulfur subunit into respiratory chain complex III, result in a wide variety of clinical phenotypes that range from the relatively mild Björnstad syndrome to the severe GRACILE syndrome. To better understand the pathophysiological consequences of such mutations, we studied fibroblasts from six complex III‐deficient patients harboring mutations in the BCS1L gene. Cells from patients with the most severe clinical phenotypes exhibited slow growth rates in glucose medium, variable combined enzyme deficiencies, and assembly defects of respiratory chain complexes I, III, and IV, increased H2O2 levels, unbalanced expression of the cellular antioxidant defenses, and apoptotic cell death. In addition, all patients showed cytosolic accumulation of the BCS1L protein, suggestive of an impaired mitochondrial import, assembly or stability defects of the BCS1L complex, fragmentation of the mitochondrial networks, and decreased MFN2 protein levels. The observed structural alterations were independent of the respiratory chain function and ROS production. Our results provide new insights into the role of pathogenic BCS1L mutations in mitochondrial function and dynamics. Hum Mutat 31:–12, 2010.

Kearns-Sayre syndrome: cerebral folate deficiency, MRI findings and new cerebrospinal fluid biochemical features.

We evaluated cerebrospinal fluid (CSF) 5-methyltetrahydrofolate (5-MTHF), biogenic amines, and white matter status in six Kearns-Sayre syndrome (KSS) patients. They presented severe 5-MTHF deficiency. A significant negative correlation was observed between CSF 5-MTHF and protein concentration. CSF homovanillic acid was clearly high. Regarding neuroimaging, the main feature was hyperintensity in the basal ganglia, brainstem, and cerebral/cerebellar white matter. The severity of hemispheric white matter disturbances appeared to be qualitatively associated with 5-MTHF values. The negative correlation between 5-MTHF and proteins supports the hypothesis of impaired choroid plexus function. Interestingly, despite very low 5-MTHF, clearly high neurotransmitter metabolites were found.

Covariate effects on the apparent clearance of tacrolimus in paediatric liver transplant patients undergoing conversion therapy.

ObjectiveTo analyse the influence of covariates on the apparent clearance (CL) of tacrolimus in paediatric liver transplant recipients being converted from cyclosporin to tacrolimus.DesignRetrospective modelling study.Patients and participants18 children, 13 girls and 5 boys, aged 4 months to 16 years (median 9.1 years) who required conversion to tacrolimus because of acute or chronic rejection or cyclosporin toxicity.Methods287 whole-blood tacrolimus concentrations from therapeutic drug monitoring were used to build a nonlinear mixed-effects population model (NON-MEM program) for the apparent clearance of tacrolimus. Variables considered were age, total bodyweight (TBW), body surface area (BSA), time after initiation of treatment (T), gender, haematocrit (Hct), albumin (Alb), aspartate aminotransferase (AST), alanine aminotransferase (ALT), γ-glutamyl transpeptidase (γGT), alkaline Phosphatase (ALP), bilirubin (BIL), Creatinine clearance (CLcr) and dosage of concomitant corticosteroids (EST).ResultsTBW, T, BIL and ALT were the covariates that displayed a significant influence on CL according to the final regression model: CL (L/h) = 10.4(TBW/70)¾ · e-000032 T· e-0.057 BIL. (1- 0.079 ALT). With this model, the estimates of the coefficients of variation were 24.3% and 29.5% for interpatient variability in CL and residual variability, respectively.ConclusionsThe proposed model for tacrolimus CL can be applied for a priori dosage calculations, although the results should be used with caution because of the unexplained variability in the CL. We therefore recommended close monitoring of tacrolimus whole blood concentrations, especially within the first months of treatment. The best use of the model would be its application in dosage adjustment based on therapeutic drug monitoring and the Bayesian approach.

Infantile mitochondrial encephalomyopathy with unusual phenotype caused by a novel BCS1L mutation in an isolated complex III-deficient patient

Mutations in BCS1L, a respiratory chain complex III assembly chaperone, constitute a major cause of mitochondrial complex III deficiency and are associated with GRACILE and Björnstad syndromes. Here we describe a 4-year-old infant with hyperlactacidemia, mild liver dysfunction, hypotonia, growth and psychomotor retardation, dysmorphic features and mitochondrial complex III deficiency. Respiratory chain enzyme activities showed an isolated complex III defect in muscle and fibroblasts. Sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis revealed a novel homozygous BCS1L mutation, c.148A>G, which caused a p.T50A substitution at an evolutionarily conserved BCS1L region. The severity of the complex III enzyme defect correlated with decreased amounts of BCS1L and respiratory chain complex III in the affected tissues. Our findings support a pathogenic role for the novel BCS1L mutation in a patient with a singular clinical phenotype.

Impact of the Mitochondrial Genetic Background in Complex III Deficiency

Background In recent years clinical evidence has emphasized the importance of the mtDNA genetic background that hosts a primary pathogenic mutation in the clinical expression of mitochondrial disorders, but little experimental confirmation has been provided. We have analyzed the pathogenic role of a novel homoplasmic mutation (m.15533 A>G) in the cytochrome b (MT-CYB) gene in a patient presenting with lactic acidosis, seizures, mild mental delay, and behaviour abnormalities. Methodology Spectrophotometric analyses of the respiratory chain enzyme activities were performed in different tissues, the whole muscle mitochondrial DNA of the patient was sequenced, and the novel mutation was confirmed by PCR-RFLP. Transmitochondrial cybrids were constructed to confirm the pathogenicity of the mutation, and assembly/stability studies were carried out in fibroblasts and cybrids by means of mitochondrial translation inhibition in combination with blue native gel electrophoresis. Principal Findings Biochemical analyses revealed a decrease in respiratory chain complex III activity in patients skeletal muscle, and a combined enzyme defect of complexes III and IV in fibroblasts. Mutant transmitochondrial cybrids restored normal enzyme activities and steady-state protein levels, the mutation was mildly conserved along evolution, and the probands mother and maternal aunt, both clinically unaffected, also harboured the homoplasmic mutation. These data suggested a nuclear genetic origin of the disease. However, by forcing the de novo functioning of the OXPHOS system, a severe delay in the biogenesis of the respiratory chain complexes was observed in the mutants, which demonstrated a direct functional effect of the mitochondrial genetic background. Conclusions Our results point to possible pitfalls in the detection of pathogenic mitochondrial mutations, and highlight the role of the genetic mtDNA background in the development of mitochondrial disorders.

Lack of gastrointestinal symptoms in a 60-year-old patient with MNGIE

Mitochondrial neurogastrointestinal encephalopathy (MNGIE) is an autosomal recessive multisystem disorder caused by mutations in the thymidine phosphorylase gene ( TP ).1 The disease is characterized by onset between the first and fifth decades of life, ptosis, progressive external ophthalmoparesis, peripheral neuropathy, and leukoencephalopathy.1,2⇓ Gastrointestinal (GI) involvement is a major hallmark of the disease, and all reported patients have GI dysmotility.2-4⇓⇓ We report a 60-year-old woman born after a normal pregnancy. She had bilateral ptosis since childhood and tremor affecting hands and head since age 2 years. She was 145 cm tall and weighed 41 kg at age 60 years. Neurologic examination at age 60 years showed bilateral ptosis with bilateral external ophthalmoplegia. Optic fundi were normal without retinitis. Strength was normal, but she had areflexia. She also had action and rest tremor. Her maternal grandfather and her daughter had tremor. Echocardiography revealed a mild thickening in the septum heart muscle. She had no GI symptoms. A radionuclide gastric emptying test showed mild gastroparesis. Laboratory data showed elevated venous lactate at rest (4.1 mmol/L; normal, 0.9 to 2.7). Brain MRI revealed diffuse hyperintense signal affecting the white matter of the cerebral hemispheres, midbrain, and pons. Abundant cytochrome c oxidase (COX)-negative ragged-red fibers and lipid droplets were found in biceps muscle biopsy (figure). The patient’s sister had short stature, and the patient’s …

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Secondary coenzyme Q10 deficiencies in oxidative phosphorylation (OXPHOS) and non-OXPHOS disorders.

We evaluated the coenzyme Q₁₀ (CoQ) levels in patients who were diagnosed with mitochondrial oxidative phosphorylation (OXPHOS) and non-OXPHOS disorders (n=72). Data from the 72 cases in this study revealed that 44.4% of patients showed low CoQ concentrations in either their skeletal muscle or skin fibroblasts. Our findings suggest that secondary CoQ deficiency is a common finding in OXPHOS and non-OXPHOS disorders. We hypothesize that cases of CoQ deficiency associated with OXPHOS defects could be an adaptive mechanism to maintain a balanced OXPHOS, although the mechanisms explaining these deficiencies and the pathophysiological role of secondary CoQ deficiency deserves further investigation.

Mild ocular myopathy associated with a novel mutation in mitochondrial twinkle helicase.

Autosomal dominant PEO is associated with mutations in a number of nuclear genes affecting the intergenomic communication with mitochondrial DNA. We report a Spanish family showing a mild phenotype characterized by autosomal dominant ocular myopathy and morphological signs of mitochondrial dysfunction, that harboured a novel c.1071G>C (p.R357P) mutation in the hot-spot linker region of the twinkle protein.