Alison K. Huttly

Isolation and Expression of Three Gibberellin 20-Oxidase cDNA Clones from Arabidopsis

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from Arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1–2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1–2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Aphid alarm pheromone produced by transgenic plants affects aphid and parasitoid behavior

The alarm pheromone for many species of aphids, which causes dispersion in response to attack by predators or parasitoids, consists of the sesquiterpene (E)-β-farnesene (Eβf). We used high levels of expression in Arabidopsis thaliana plants of an Eβf synthase gene cloned from Mentha × piperita to cause emission of pure Eβf. These plants elicited potent effects on behavior of the aphid Myzus persicae (alarm and repellent responses) and its parasitoid Diaeretiella rapae (an arrestant response). Here, we report the transformation of a plant to produce an insect pheromone and demonstrate that the resulting emission affects behavioral responses at two trophic levels.

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

CLAVATA1 dominant-negative alleles reveal functional overlap between multiple receptor kinases that regulate meristem and organ development

The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain.

Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridization: expression of the tonoplast water channel, γ-TIP, is increased by GA3

The Arabidopsis ga1 mutant has very low levels of endogenous, active gibberellins and thus has an extreme dwarf phenotype; application of GA3 induces stem elongation and flower development. To test the hypothesis that GA action in this system involves changes in gene expression, we have cloned mRNAs whose abundance changes following GA application. A subtraction cloning scheme for the isolation of differentially regulated cDNAs was established, involving hybridization of single-stranded cDNA to biotinylated mRNA. cDNA populations enriched up to 150-fold in GA-regulated sequences were produced and cDNA libraries generated. Screening of these libraries has isolated two clones that identify mRNAs of ca. 1100 and 750 bases whose abundance is markedly increased 24 h after GA application. One of these clones encodes the vegetative form of the Arabidopsis tonoplast intrinsic protein (γ-TIP), a water channel protein, the expression of which has recently been shown to be correlated with regions of cell expansion. The second clone is expressed only in the inflorescence and encodes a proline- and glycine-rich protein that may be a cell wall component.

The wheat chloroplast gene for CF0 subunit I of ATP synthase contains a large intron

The gene for CF0 subunit I of ATP synthase has been located in wheat chloroplast DNA, between the genes for CF0 subunit III and α subunit of CF1. Nucleotide sequencing and analysis of RNA‐DNA hybrids indicated that the gene is interrupted by an 823‐bp intron which has boundaries similar to those previously described for the introns in protein‐coding chloroplast genes of Euglena gracilis. The deduced amino acid sequence of CF0 subunit I indicates a polypeptide of 183 amino acid residues. However, N‐terminal amino acid sequencing of the mature spinach CF0 subunit I suggests that the protein is synthesised with a N‐terminal extension of 17 amino acid residues and is processed to give a protein of mol. wt. 19 001 of 166 amino acids residues. The mature CF0 subunit I shows similarities in primary and predicted secondary structure to F0 subunit b of Escherichia coli ATP synthase. A major transcript of 3.3 kb containing sequences from the genes for CF0 subunit III, subunit I and CF1 subunit α has been observed by RNA‐DNA hybridisation.

A sixth subunit of ATP synthase, an F0 component, is encoded in the pea chloroplast genome

DNA from pea and tobacco chloroplasts hybridizes specifically with probes derived from the gene for a membrane component, the a subunit of ATP synthase of the cyanobacterium, Synechococcus 6301. DNA sequence of the hybridizing region of the pea plastid DNA has revealed that it encodes a protein of 247 amino acids related in sequence to the a subunits of ATP synthase of Escherichia coli, Synechococcus and mitochondria. This is the sixth component of chloroplast ATP synthase that is plastid coded. The gene is located upstream from the genes for three other ATP synthase subunits and a transcript of 6 kb contains coding sequences from each of these genes. Thus the subunit a gene is part of a co‐transcribed cluster of four ATP synthase genes arranged in the order a:c(or III):b(or I):α. Two other ATP synthase genes, those for β and ε subunits, are known to form a separate cluster. These gene arrangements are most closely related to those found in the cyanobacterium, Synechococcus 6301. Hence, this finding provides strong evidence for a common origin for cyanobacteria and plant chloroplasts.

Gibberellin-regulated expression in oat aleurone cells of two kinases that show homology to MAP kinase and a ribosomal protein kinase

AbstractcDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

A novel wheat α-amylase gene (α-Amy3)

SummaryA genomic clone of a wheat α-amylase gene (λAmy3/33) was identified, on the basis of hybridisation properties, as different from α-Amy1 and α-Amy2 genes which had been characterised previously. The nucleotide sequence revealed that this gene has the normal sequence motifs of an active gene and an open reading frame interrupted by two introns. The protein sequence encoded by this open reading frame is recognisably similar to that of α-amylase from the α-Amy1 and α-Amy2 genes and there is high sequence homology in all three proteins at the putative active sites and Ca++ binding region. In addition, the introns are at positions equivalent to the position of introns in the α-Amy1 and α-Amy2 genes. However, the sequence was less similar to α-Amy1 and α-Amy2 than these are to each other. Southern blot analysis showed that the λAmy3/33 DNA is one of a small multigene family carried on a different chromosome (group 5) from either the α-Amy1 or α-Amy2 genes. A further difference from the α-Amy1 and α-Amy2 genes was the pattern of expression. λAmy3/33 was expressed only in immature grains and, unlike the α-Amy1 and α-Amy2 genes, not at all in germinating aleurones. These data suggested therefore that this gene represents a third type of α-amylase gene, not described before, which shares a common evolutionary ancestor with the α-Amy1 and α-Amy2 genes.

Characterization of a cDNA from Arabidopsis thaliana encoding a potential thiol protease whose expression is induced independently by wilting and abscisic acid.

The sequence and expression characteristics are described of a wilt-inducible gene in Arabidopsis thaliana. A 1494 encodes a potential thiol protease whose mRNA accumulates rapidly in shoot tissue upon the loss of turgor. A1494 mRNA levels peaked after ca. 4 h and declined thereafter. Dehydration also induced rapid biosynthesis of the phytohormone abscisic acid (ABA), which continued for at least 9 h. Exogenous ABA induced the accumulation of A1494 mRNA, with kinetics similar to those after wilting. Rehydration of wilted shoots led to a rapid decline in the content of both ABA and A1494 mRNA. Wilting and ABA independently induced A1494 expression as evidenced by the effects of ABA and wilting on the ABA-deficient aba-1 and ABA-insensitive abi-1 and abi-3 genotypes. A1494 mRNA was not detectable in aba-1 shoots but accumulated rapidly after either wilting or ABA treatment, whereas the shoot ABA content was increased only by ABA treatment. ABA had no effect on A1494 mRNA levels in the abi-1 and abi-3 mutants but wilting did result in enhanced A1494 expression. Heat shock had only a minor effect on A1494 mRNA levels, whereas exposure to low temperature resulted in substantial accumulation of A1494 mRNA in wild-type shoots. However, this latter response, unlike that to drought, was mediated exclusively via ABA synthesis as demonstrated by the lack of A1494 mRNA accumulation in cold-treated aba-1 shoots.