Álvaro Fabrício Lopes Rios

Use of the TSPY gene for sexing cattle

The Y-encoded, testis-specific protein (TSPY) is a Y-specific gene. The copy numbers of TSPY range from 20 to 60 in men and up to 200 in bulls. In this study, we examined the possibility of using the TSPY gene to sex cattle. DNA from blood samples of 100 Nelore cattle (50 males and 50 females) from the Nelore Cattle Breeding Program (PMGRN) was screened for TSPY by PCR using TSPY-specific primers. The assay was highly specific since all male samples were TSPY-positive and all female samples were negative. Positive results were also obtained at low DNA concentrations (less than 1 rg/mL). These results showed that TSPY was a good male-specific marker, the usefulness of which was enhanced by the high copy number of the gene. This is the first report to demonstrate the applicability of TSPY for sexing cattle.

Bovine fetal DNA in the maternal circulation: Applications and implications

OBJECTIVE The main aim of the present study was to detect bovine fetal DNA in the maternal circulation, a relatively unexplored subject in the literature. STUDY DESIGN DNA was extracted from blood of 84 primipara cows (Bos indicus) at different gestational ages (30-270 days) and from 100 adult animals (50 males and 50 non-pregnant cows). The samples were analyzed using PCR with primers for TSPY gene. RESULTS Molecular results matched the fetal phenotypic gender in all 47 male and 37 female fetuses, including early pregnancy, and in control animals. CONCLUSIONS These results evidence a bovine transplacental fetal DNA passage.

TSPY detection in blood, buccal, and urine cells of patients with 45,X karyotype

Patients with dysgenetic gonads and Y-chromosome have an increased risk of developing gonadal tumors. In cases of hidden mosaicism, the conventional cytogenetic techniques may be ineffective and a complementary molecular investigation is indicated [Hall, 2002; Nishi et al., 2002; Alvarez-Nava et al., 2003]. From 239 patients with Ullrich–Turner syndrome (UTS) stigmata, 30 cases with 45,X karyotype, without mosaicism detected by cytogenetic analysis of 100 metaphases, were selected and 29 samples of peripheral blood, 29 of buccal cells, and 26 of urine were collected. Written consent was obtained from all patients or their parents or tutors. The study was first approved by the Research Ethics Committee of the Clinical Hospital of the School of Medicine of Ribeirao Preto-University of Sao Paulo. In order to avoid contamination, patients with recent history of sexual intercourse were excluded and only women performed the laboratory manipulation. DNA was extracted from peripheral blood and buccal cells as described by Miller et al. [1988] and Chu and Connor [1995], respectively. For urinary tract cells, a protocol described by Gasparini et al. [1989] was modified as follow: 50 ml of urine was collected and centrifuged; the pellet formed was resuspended in 0.9% saline solution. After five washings, the pellet was resuspended in 100 ml of water and boiled for 20 min. The debris was centrifuged until a pellet was formed (13,000 rpm for 10 min), and the supernatant was used for DNA amplification [Caetano, Rios, Santos, Floria, Martelli, Ramos, unpublished results]. Three different multiplex PCRs were performed to detect DAZ/b-globine, SRY/b-globine, and TSPY/GAPDH sequences in blood. The primers were as follows: DAZ (TAAATCTGTTGGATCCTCTCAGC and CACAGAACCAGGTTCTAAATAAACA) [Reijo et al., 1995]; SRY (GGAATTCCCTAACTCTAAGTATCAGTGT and (GGAATTCCGCAAACTGCAATTCTTCGGC) [Sinclair et al., 1990]; TSPY (GTGGAAGAAGAGAAGCATCC and GAGTGGAATGAGAAGCCCTG) [Ratti et al., 2000], bglobine (TAGTCCCACTGTGGACTACTT and CCTGAGAGCTTGCTAGTGATT) [Guerreiro et al., 1992], GAPDH (CATCCCTTCTCCCCACACAC and AGTCCCCTGACGTCTCTGTT) [de Cremoux et al., 1997]. Nested PCR was performed with DNA samples of buccal and urine cells with the primers TSPY out (CTGACGAAGATGAAGACATGC and AGTCCCCTGACGTCTCTGTT) and the former described. The first PCR reaction for the TSPY gene was performed for all the 29 samples of blood and nested PCR for all the 29 samples of buccal cells and the 26 samples of urine. Each reaction was also performed with five masculine, five feminine, and negative controls. PCR products were analyzed in 2% agarose gels and captured in a Kodak Digital Science Analysis System. A preliminary study with a control group was performed for urine samples and nested PCR for the TSPY gene, including normal men and women (without a previous pregnancy) and patients with different proportions of the mosaicism 45,X/ 46,XY [Caetano, Rios, Santos, Floria, Martelli, Ramos, unpublished results]. There were no positive results for SRY and DAZ in blood samples. One blood sample [1/29 (3.4%)] was TSPY-positive after the first PCR reaction. From 29 buccal cell samples, one [1/29 (3.4%)] was TSPY-positive (after the nested PCR), while from 26 urine samples, 5 [5/26 (19.2%)] were positives (after the nested PCR). Both patients that had positive results in peripheral blood and buccal cells also had positive results in urine. All the reactions were repeated at least twice for assurance. All cases of normal men showed the TSPY sequence in urine after nested PCR and no normal women, without previous pregnancy or recent history of sexual intercourse, presented positive results. Urine has not been extensively used as a genomic DNA source because it presents a small cell number, and elevated concentrations of urea, heavy metals, and proteins can act as PCR inhibitors [Buffone et al., 1991]. However, its molecular analysis is a method of interest, because it is an alternative to invasive procedures like skin biopsies and it may be more informative about the gonadal cell lineage than blood or skin, due to its embryological origin. The results found in this study are discordant with some data in the literature. According to some authors, the frequency of hidden mosaicism is less than 1% [Larsen et al., 1995], but these data need to be better evaluated, because the analysis of different tissues in preor neonatal periods could demonstrate, with more reliability, the presence or absence of mosaicism [Hall, 2002]. Nishi et al. [2002] believe that nested PCR is not a reliable method for detection of Y-chromosome sequences in peripheral blood. However, in our protocol this technique was employed in urine as a screening test and as a complement for cytogenetic and traditional PCR analysis. In the future, real-time PCR may replace nested PCR for this purpose. The patients in whom the authors found sequences of the TSPY gene have been subsequently monitored more carefully with ultrasounds and magnetic resonance imaging. The association of molecular methods with complementary examinations for patients with UTS stigmata and 45,X karyotype can be useful in diagnosis, treatment, follow-up, and genetic counseling of these women.

Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners.

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners.

5meCpG Epigenetic Marks Neighboring a Primate-Conserved Core Promoter Short Tandem Repeat Indicate X-Chromosome Inactivation

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates.

Expression of the CTCF gene in bovine oocytes and preimplantation embryos

The CCCTC - binding factor (CTCF) is a protein involved in repression, activation, hormone-inducible gene silencing, functional reading of imprinted genes and X-chromosome inactivation. We analyzed CTCF gene expression in bovine peripheral blood, oocytes and in different cellular stages (2-4 cells, 8-16 cells, 16-32 cells, morulae, and blastocysts) of in vitro fertilized embryos. This is the first report of CTCF expression in oocytes and preimplantation bovine embryos and has implications for the production of embryonic stem cells and the development of novel medical technologies for humans.