Anand S. R. Muthusamy

Peripheral Blood Sampling for the Detection of Allograft Rejection: Biomarker Identification and Validation

Currently, acute allograft rejection can only be detected reliably by deterioration of graft function confirmed by allograft biopsy. A huge drawback of this method of diagnosis is that substantial organ damage has already taken place at the time that rejection is diagnosed. Discovering and validating noninvasive biomarkers that predict acute rejection, and chronic allograft dysfunction, is of great importance. Many studies have investigated changes in the peripheral blood in an attempt to find biomarkers that reflect changes in the graft directly or indirectly. Herein, we will review the promises and limitations of the peripheral blood biomarkers that have been described in the literature so far.

Alemtuzumab Induction and Steroid‐Free Maintenance Immunosuppression in Pancreas Transplantation

Alemtuzumab is a humanized anti‐CD52 antibody that depletes lymphocytes and has been increasingly used as induction agent in transplantation. The impact of alemtuzumab induction immunosuppression in pancreas transplantation was evaluated, with particular reference to steroid avoidance in maintenance.

Pancreas Transplantation From Donors After Circulatory Death From the United Kingdom

This study reports the comparative short‐term results of pancreas transplantation from donors after circulatory death (DCD) (Maastricht III & IV), and pancreases from brainstem deceased donors (DBD). Between January 2006 and December 2010, 1009 pancreas transplants were performed in the United Kingdom, with 134 grafts from DCD and 875 from DBD. DCD grafts had no premortem pharmacological interventions performed. One‐year pancreas and patient survival was similar between DCD and DBD, with pancreas graft survival significantly better in the DCD cohort if performed as an SPK. Early graft loss due to thrombosis (8% vs. 4%) was mainly responsible for early graft loss in the DCD cohort. These results from donors with broader acceptance criteria in age, body mass index, premortem interventions, etc. suggest that DCD pancreas grafts may have a larger application potential than previously recognized.

Pancreas allograft thrombosis.

Thrombosis of the transplanted pancreas is a common and often catastrophic event. Predisposing factors include the hypercoagulable state of many patients with diabetic renal failure, preservation-related graft endothelial injury, and low-velocity venous flow. Clinical management includes optimization of modifiable risk factors, controlled anticoagulation, graft monitoring, and early therapeutic intervention.

Pretransplant serum CXCL9 and CXCL10 levels fail to predict acute rejection in kidney transplant recipients receiving induction therapy.

Urinary CXCL9 and CXCL10 levels have been described as up-regulated in kidney transplant recipients (KTRs) during acute rejection (AR), suggesting that urinary CXCR3-binding chemokines may be of predictive and diagnostic value (1, 2). Indeed, high pretransplant serum CXCL9 and CXCL10 levels were found to be associated with lower 5-year graft survival rates and AR within the first year after kidney transplantation, a finding interpreted as suggesting that pretransplant CXCR3-binding chemokine assessment may identify patients at risk for AR and graft loss (3, 4). In the latter two studies, KTRs receiving induction therapy were excluded from the analysis, potentially obscuring the clinical usefulness of these findings, because the majority of KTRs now receive some form of induction therapy (5). To address this issue, we have investigated whether pretransplant serum CXCL9 and CXCL10 levels are also predictive for AR in KTRs receiving basiliximab or alemtuzumab induction therapy as risk stratification based on biomarkers is of great potential benefit for KTRs. Sixty-four KTRs, 44 receiving basiliximab, tacrolimus, and steroids, with azathioprine or mycophenolate mofetil, and 20 receiving alemtuzumab, tacrolimus, and mycophenolate mofetil were enrolled. Of this cohort, 10 patients experienced a biopsy-proven AR episode and 2 patients had an AR episode diagnosed by clinical criteria without biopsy confirmation within the first year after transplantation. Pretransplantserumsampleswereassayed in duplicate for CXCL9 and CXCL10 levels by enzyme-linked immunosorbent assay (R&D Systems, Abingdon, UK) following the manufacturer’s instructions. Total leukocyte CXCR3 (ABI assay ID Hs00171041 m1) and hypoxanthine phosphoribosyltransferase (HPRT) (forward primer TGCTTTCCTTGGTCAGGCAGTA, reverse primer TCCAACAAAGTCTGGCTTATATCCA, and probe TCAAGGTCGCAAGCTTGCTGGTGAAA) gene expression were determined using standard real-time reverse-transcriptase polymerase chain reaction techniques. For statistical analysis, the Mann-Whitney U test was used, and P values less than 0.05 were considered significant. Results in the text are expressed as mean standard deviation. Pretransplant demographics were similar between patients with and without AR, except for gender distribution (data not shown). End-stage renal disease patients had significantly higher CXCL9 levels and similar CXCL10 levels compared with healthy controls (data not shown). When patients were grouped based on the occurrence of AR within 1 year after transplantation, no significant difference in CXCL9 levels (296.4 452.9 vs. 150.1 88.4, P not significant; Fig. 1A) or CXCL10 levels (158.2 91.2 vs. 103.2 32.9, P not significant; Fig. 1B) between nonrejecting patients and patients with AR was observed. Rotondi et al. (4) described cutoff values for CXCL9 and CXCL10 of 272.1 and 133.2 pg/mL, respectively, as useful for identifying patients with higher immunologic risk. To explore the lack of predictive value of CXCL9 and CXCL10 levels for AR in the patient cohort analyzed in this study, separately and combined, we stratified into high and low CXCL9 and CXCL10 levels based on these cutoff values. Only 1 patient had high CXCL9 levels, 20 patients had high CXCL10 levels, and 11 patients had high levels of both (Fig. 1C). The sole patient with high CXCL9 levels did not develop AR, whereas two patients with high CXCL10 levels (10%) and one patient with high levels of both (9%) experienced AR. For the patients with only high CXCL10 levels, it should be noted that CXCL10 levels were just above the cutoff (133.4 and 147.1 pg/mL, respectively). The finding that CXCR3-binding chemokine levels fail to predict AR in alemtuzumab-treated KTRs may be explained by the rapid lymphocyte depletion (6) (Fig. 1D). Consequently, cells responsive to CXCL9 and CXCL10 are lost, confirmed by decreased CXCR3 gene expression (Fig. 1E). Basiliximab does not cause lymphocyte depletion but impairs T-cell activation by interleukin2R -chain blockade (7). Because activation is required for CXCR3 expression (8), basiliximab may prevent CXCR3 expression, rendering T cells unresponsive to CLCL9 and CXCL10 signaling. At the time of writing, two patients lost their grafts, one because of AR and one because of cytomegalovirus infection. The former had CXCL9 and CXCL10 levels below the cutoff values, and the latter had CXCL10 levels above the cutoff value (205.9 pg/mL). The demonstration that pretransplant serum CXCL9 and CXCL10 levels failed to predict AR in patients receiving basiliximab or alemtuzumab induction therapy stresses the importance of performing biomarker studies in patients receiving different immunosuppressive regimens. To be widely applicable, any biomarker should be capable of defining patients at risk irrespective of the immunosuppressive regimen.

Successful transplantation of porcine liver grafts following 48-hour normothermic preservation.

Current cold storage organ preservation technique fails to preserve marginal donor grafts sufficiently. Evidence from large animal experiments suggests superiority of normothermic machine preservation of liver allografts. Long-term organ preservation using normothermic perfusion might not only allow organ viability assessment before transplantation, but also provide the means for further organ modifications under physiologic conditions. Previous research has shown that porcine livers can be transplanted successfully after normothermic preservation of 20 hours. In the present study we investigate whether similar methodology is capable of further extending the safe limit to 48 hours. In this study, livers from White Landrace pigs were preserved by normothermic, oxygenated sanguineous perfusion. After a 48-hour period of preservation, livers were transplanted into recipient pigs and followed for 5 days. Outcome parameters measured included markers of synthetic and metabolic liver function as well as hepatocellular injury and blood gas analysis during perfusion and follow-up. Histological assessment of morphological liver integrity was performed. All livers showed sustained bile production and metabolic activity throughout the preservation period. Low levels of hepatocellular damage were found. Following transplantation all liver grafts revealed excellent graft function and death-censored graft survival was 100%. Porcine livers were transplanted successfully following 48 hours normothermic machine preservation.

Pancreas Transplantation From Donors After Circulatory Death From the United Kingdom: Pancreas Transplantation From Donors

Our report on DCD pancreas transplantation in the United Kingdom (2) was based upon information supplied by the centers to the UK Transplant Registry. The assumption stated in our paper of a maximum of 60 min from withdrawal to cardiac arrest reflected a general consensus amongst the centers involved in DCD pancreas transplantation in the United Kingdom and we accept both that this is an arbitrary stipulation and that there were exceptions to this rule.

Revascularization of the gastro-epiploic artery in pancreas transplant

We read with interest the article on revascularization of the gastro-epiploic artery in pancreas transplants [1], in which the author describes personal experience in 110 consecutive pancreas transplants. We agree that the revascularization of the head of the pancreas is critical in ensuring the viability of the duodenum, and that there are instances where arterial inflow through either superior or inferior pancreatico duodenal artery is compromised. The author reports the use of the gastro-epiploic artery to provide retrograde flow into the gastro-duodenal artery from the infra-pancreatic superior mesenteric arterial branches. We have some specific concerns regarding the use of the infra-pancreatic superior mesenteric arterial branches for reconstructing the inflow. The root of the mesentery is highly vascular, containing a leash of vessels originating from the main trunk of the superior mesenteric artery (SMA) posterior to the uncinate process. Dissecting the infra-pancreatic SMA to provide inflow has to be meticulous to ensure that the inferior pancreatico duodenal artery is spared. This dissection is difficult and time-consuming, as there are multiple branches to be dealt with, and can increase the operative time significantly. Moreover, various authors have described alternative techniques for revascularizing the gastro-duodenal artery, either using a Y graft [2] or using a segment of donor external iliac artery implanted separately [3] or end-side to the splenic artery [4]. Neither of these techniques requires complex dissection during procurement, and both can be performed safely during bench reconstruction. In our series of consecutive 240 pancreas transplants, we have used the latter technique successfully in three cases where the inferior pancreatico duodenal artery was divided because of a right hepatic artery arising high from the superior mesenteric artery. In one instance, we used the anterior and posterior divisions of the donor internal iliac artery to perform the revascularization procedure. During procurement, the internal iliac artery is carefully dissected ensuring that the anterior and posterior divisions are intact. On the bench, the branches of the anterior and posterior divisions (superior vesical, uterine/ deferential, superior gluteal, iliolumbar, lateral sacral etc) are ligated, and the anterior division is anastomosed endto-end to the gastro-duodenal artery, the posterior division to the superior mesenteric artery and the external iliac artery to the splenic artery. The recipient of this pancreas had no postoperative complications and has excellent graft function at 12-month post-transplant. We are also interested in the author’s practice of using renograffin (diatrizoate) to perform the on-table angiograms. This ionic contrast agent has been reported to cause endothelial injury following administration [5] (demonstrated by elevated von Willebrand factor levels). This endothelial activation has been shown to have a role in graft thrombosis [6]. We note that the author describes four cases of graft thrombosis in 110 transplants, but none in the grafts undergoing the triple revascularization. We would be interested in the author’s opinion on the potential role of this contrast agent in the development of graft thrombosis.

Complex arterial reconstruction for pancreas transplantation in recipients with advanced arteriosclerosis.

Feasibility of left lobe living donor liver transplantation between adults: An 8-year, single-center experience of 107 cases. Am J Transplant 2006; 6: 1004. 3. Ikegami T, Nishizaki T, Yanaga K, et al. Changes in the caudate lobe that is transplanted with extended left lobe liver graft from living donors. Surgery 2001; 129: 86. 4. Sugawara Y, Makuuchi M, Imamura H, et al. Living donor liver transplantation in adults: Recent advances and results. Surgery 2002; 132: 348. 5. Todo S, Furukawa H, Jin MB, et al. Living donor liver transplantation in adults: Outcome in Japan. Liver Transpl 2000; 6: S66. 6. Yonemura Y, Taketomi A, Soejima Y, et al. Validity of preoperative volumetric analysis of congestion volume in living donor LT using three-dimensional computed tomography. Liver Transpl 2005; 11: 1556.