Angélica Vargas

Joint and tendon subclinical involvement suggestive of gouty arthritis in asymptomatic hyperuricemia: an ultrasound controlled study

IntroductionIn this study, we aimed to investigate ultrasonographic (US) changes suggestive of gouty arthritis in the hyaline cartilage, joints and tendons from asymptomatic individuals with hyperuricemia.MethodsWe conducted a cross-sectional, controlled study including US examinations of the knees and first metatarsal-phalangeal joints (first MTPJs), as well as of the tendons and enthesis of the lower limbs. Differences were estimated by χ2 or unpaired t-tests as appropriate. Associations were calculated using the Spearmans correlation coefficient rank test.ResultsFifty asymptomatic individuals with hyperuricemia and 52 normouricemic subjects were included. Hyperechoic enhancement of the superficial margin of the hyaline cartilage (double contour sign) was found in 25% of the first MTPJs from hyperuricemic individuals, in contrast to none in the control group (P < 0.0001). Similar results were found on the femoral cartilage (17% versus 0; P < 0.0001). Patellar enthesopathy (12% versus 2.9%; P = 0.01) and tophi (6% versus 0; P = 0.01) as well as Achilles enthesopathy (15% versus 1.9%; P = 0.0007) were more frequent in hyperuricemic than in normouricemic individuals. Intra-articular tophi were found in eight hyperuricemic individuals but in none of the normouricemic subjects (P = 0.003).ConclusionsThese data demonstrate that morphostructural changes suggestive of gouty arthritis induced by chronic hyperuricemia frequently occur in both intra- and extra-articular structures of clinically asymptomatic individuals.

Clinical Anatomy of the Ankle and Foot

This paper emphasizes the anatomical substrate of several foot conditions that are seldom discussed in this context. These include the insertional and non-insertional Achilles tendinopathies, plantar fasciopathy, inferior and posterior heel spurs, foot compartment syndromes, intermetatarsal bursitis and Mortons neuroma. It is a rather superficial anatomical review of an organ that remains largely neglected by rheumatologists. It is our hope that the cases discussed and the cross examination by instructors and participants will stimulate study of the foot and the attention it deserves.

Clinical Anatomy of the Hand

This article reviews the underlying anatomy of trigger finger and thumb (fibrous digital pulleys, sesamoid bones), flexor tenosynovitis, de Quervains syndrome, Dupuytrens contracture, some hand deformities in rheumatoid arthritis, the carpal tunnel syndrome and the ulnar nerve compression at Guyons canal. Some important syndromes and structures have not been included but such are the nature of these seminars. Rather than being complete, we aim at creating a system in which clinical cases are used to highlight the pertinent anatomy and, in the most important part of the seminar, these pertinent items are demonstrated by cross examination of participants and teachers. Self learning is critical for generating interest and expanding knowledge of clinical anatomy. Just look at your own hand in various positions, move it, feel it, feel also your forearms while you move the fingers, do this repeatedly and inquisitively and after a few tries you will have developed not only a taste, but also a lifelong interest in clinical anatomy.

Clinical Anatomy of the Knee

The clinical anatomy of several pain syndromes of the knee is herein discussed. These include the iliotibial tract syndrome, the anserine syndrome, bursitis of the medial collateral ligament, Bakers cyst, popliteus tendon tenosynovitis and bursitis of the deep infrapatellar bursa. These syndromes are reviewed in terms of the structures involved and their role in knee physiology. All of the discussed structures can be identified in their normal state and more so when they are affected by disease. The wealth of information gained by cross examination of the medial, lateral, posterior and anterior aspects of the knee brings to life knowledge acquired at the dissection table, from anatomical drawings and from virtual images.

Joint involvement in primary Sjögren's syndrome: an ultrasound "target area approach to arthritis".

Objective. To characterize the ultrasound (US) pattern of joint involvement in primary Sjögrens syndrome (pSS). Methods. Seventeen patients with pSS, 18 with secondary Sjögrens syndrome (sSS), and 17 healthy controls underwent US examinations of various articular regions. Synovitis (synovial hypertrophy/joint effusion), power Doppler (PD) signals, and erosions were assessed. Results. In patients with pSS, synovitis was found in the metacarpophalangeal joints (MCP, 76%), wrists (76%), and knees (76%), while the proximal interphalangeal joints, elbows, and ankles were mostly unscathed. Intra-articular PD signals were occasionally detected in wrists (12%), elbows (6%), and knees (6%). Erosions were evident in the wrists of three (18%) patients with pSS, one of these also having anti-cyclic citrullinated peptide (anti-CCP) antibodies. While US synovitis does not discriminate between sSS and pSS, demonstration of bone erosions in the 2nd MCP joints showed 28.8% sensitivity and 100% specificity for diagnosing sSS; in comparison, these figures were 72.2 and 94.1% for circulating anti-CCP antibodies. Conclusions. In pSS, the pattern of joint involvement by US is polyarticular, bilateral, and symmetrical. Synovitis is the US sign most commonly found in patients with pSS, especially in MCP joints, wrists, and knees, and bone erosions also may occur.

Reduced numbers of circulating CD28‐negative CD4+ cells in patients with rheumatoid arthritis chronically treated with abatacept

Dear Editor, Rheumatoid arthritis (RA) is a chronic, autoimmune disorder characterized by premature immunosenescence. This includes increased numbers of circulating CD4+ T cells lacking CD28 expression, a key receptor for activating second signals delivered by antigenpresenting cells. Despite the role of CD28 to ensure appropriate activation, CD4+CD28 cells from RA patients remain functionally active and have been associated with severity of disease, presence of extra-articular manifestations and early atherosclerotic changes. Abatacept (CTLA-4Ig) is a T cell costimulation blocker demonstrated to be useful in the treatment of RA. After 48 weeks therapy, abatacept restores the expression of CD28 in CD4+ cells in parallel with clinical response, suggesting an active role for these cells. Nevertheless, whether the number of circulating CD4+CD28 cells remains reduced during long-term therapy, or it is a transient phenomenon, is unclear. Thus, our aimwas to investigate the number of circulating CD4+CD28 T cells in patients with RA under long-term therapy with abatacept. The present study was conducted in a single-center, outpatient rheumatology clinic. Patients with longlasting RA meeting the 1987 American College of Rheumatology classification criteria receiving abatacept for > 5 years with adequate clinical response were eligible. Also, disease activity-matched RA patients on successful therapy with disease modifying antirheumatic drugs (DMARDs) for > 5 years who have never received biological agents were included. Ten young, healthy individuals (seven female, median age 31 years) were included as reference. This protocol was approved by the local ethics committee and conducted in accordance with the Declaration of Helsinki. An informed consent was obtained from each participant. Demographics were obtained from medical charts. Examinations were performed by a rheumatologist (CR-A) blinded to laboratory results. Disease activity was assessed by the Disease Activity Score 28 – C-reactive protein (DAS28-CRP[3]) index. Peripheral blood mononuclear cells (PBMC) were isolated by density gradient and expression of surface markers was assessed by color flow-cytometry in a FACSCalibur (BD Biosciences, San Jose, CA, USA) using monoclonal antibodies against CD4 and CD28 molecules and conjugated with phycoerythrin and allophycocyanin, respectively (BioLegend, San Diego, CA, USA). Transcript levels were measured in PBMC by reverse transcription quantitative polymerase chain reaction (RT-qPCR), using the primers: TNF (NM_000594; forward-CAGCCTCTTCTCCTTCCTGA; reverse-GCCAGAGGGCTGATTAGAGA), NFjΒ1 (NM_0 01165412; forwardACCCTGACCTTGCCTATTT; reverse AGCTCTTTTTCCCGATCTCC) and GADPH (NM_0020 46.3; forward-AGCCACATCGCTCAGACAC; reverse GC CCAATACGACCAAATCC) and universal hydrolysis probes (Roche Diagnostics, Indianapolis, IN, USA). Serum levels of interferon gamma (IFN-c), interleukin (IL)-17, IL-1b, and IL-6 were tested by enzyme-linked immunosorbent assay (ELISA) (R&D Systems, Minneapolis, MN, USA), while high-sensitivity CRP was measured by nephelometry (Beckman Coulter, Fullerton, CA, USA). All experiments were performed in accordance with the manufacturers’ instructions. Discrete variables are expressed as percentages and differences calculated by v or Fisher’s exact tests, while continuous variables are described in medians (minimum to maximum range) and compared by Kruskall-Wallis (Dunn’s multiple comparison test) or Mann-Whitney tests as appropriate. P < 0.05 was set for significance and analyses were performed in GraphPad Prism 4.02 (GraphPad Inc, San Diego, CA, USA) software. The main data of participants are described in Table 1. As noted, patients receiving abatacept had less use of antimalarials (33% vs. 87%; P = 0.04). The abatacept group showed a trend for higher serum CRP (10.4, 0.8–116 vs. 3.5, 0.7–14.8 mg/L; P = ns) even when total disease activity score was similar between RA groups (DAS28-CRP[3] index 3.6, 2.1–5.5 vs. 3.5,

Educational impact of a clinical anatomy workshop on 1st-year orthopedic and rheumatology fellows in Mexico City

We aim to study the educational impact of a clinical anatomy workshop in 1st-year orthopedic and rheumatology fellows. First-year rheumatology fellows (N = 17) and a convenience sample of 1st-year orthopedic fellows (N = 14) from Mexico City in the 9th month of training participated in the study. The pre- and the post- workshop tests included the same 20 questions that had to be answered by identification or demonstration of relevant anatomical items. The questions, arranged by anatomical regions, were asked in five dynamic stations. Overall, the 31 participants showed an increase of correct answers, from a median of 6 (range 1 to 12) in the pre-workshop test, to a median of 14 (range 7 to 19) in the post-workshop test. In the pre-workshop test, the correct median answers were 7 (range 2 to 12) in the orthopedic fellows and 5 (range 1 to 10) in the rheumatology fellows (p = 0.297). Corresponding scores in the post-workshop were 15 (range 10 to 19) and 12 (range 7 to 18) (p = 0.026) showing a significant difference favoring the orthopedic group. Our clinical anatomy workshop was efficacious, in the short term, as a teaching instrument for 1st-year orthopedic and rheumatology fellows. The post-workshop scores, although significantly improved in both groups, particularly in the orthopedic fellows, were still suboptimal. Further refinements of our workshop might yield better results.

Imagenología: nuevas técnicas usadas en la osteoartritis

Uno de los principales desafios de las tecnicas de imagen en la evaluacion de la osteoartritis es el desarrollo de metodos mas sensibles. Esta revision se enfoca en los principales metodos empleados en la valoracion del dano estructural de los pacientes con osteoartritis. La radiografia convencional es el metodo mas conocido y asequible, pero no evalua tejidos no calcificados. La imagen por resonancia magnetica permite visualizar los tejidos blandos articulares y extraarticulares, incluyendo las caracteristicas morfologicas y bioquimicas del cartilago, con la desventaja del elevado costo y su menor disponibilidad. El ultrasonido ha adquirido mayor auge por ser un metodo sencillo, economico y preciso para evaluar estructuras articulares y extraarticulares, aunque con limitada ventana acustica e incapacidad para evaluar el espacio articular.Nowadays, one of the critical challenges for imaging techniques is the development of more sensitive methods to assess osteoarthritis. This review is focused on the main methods used to evaluate anatomical damage in osteoarthritis patients. Conventional radiography is the more accessible and well known method, but can not evaluate non-calcified tissues. Magnetic resonance imaging allows visualization of articular and extraarticular soft tissues, including the morphologic and biochemical characteristics of cartilage, but it is an expensive and less accessible method. Increasing interest has been shown in ultrasonography as a suitable, non expensive and accurate method which can evaluate articular (including cartilage) and extraarticular structures, with the disadvantage of a limited acoustic window and impossibility to evaluate joint space width.

A survey of anatomical items relevant to the practice of rheumatology: pelvis, lower extremity, and gait

This study aimed to generate a minimum list of structural and functional anatomical items about the pelvis/hip, knee, ankle/foot, gait, and lower limb innervation, which are most relevant to the practice of rheumatology. To determine their perceived relevance to clinical practice, seven members of the Mexican Clinical Anatomy Task Force compiled an initial list of 470 anatomical items. Ten local and international experts according to a 0–10 Likert scale ranked these items. Of the original list, 101 (21.48%) items were considered relevant (global rate >40). These included 36/137 (26.27%) pelvis and hip items, 25/82 (30.48%) knee items, 22/168 (13.98%) ankle/foot items, 11/68 (16.17%) neurologic items, and 7/15 (46.66%) gait-related items. We propose that these 101 anatomical items of the lower extremity, when added to the 115 anatomic items of the upper extremity and spine we previously reported, may represent an approximation to the minimal anatomical knowledge central to the competent practice of rheumatology. The meager representation of ankle and foot items may reflect a lesser emphasis in these anatomical regions during rheumatologic training. Attention to these and related items during rheumatologic training and beyond may sharpen the rheumatologist’s ability in the differential diagnosis of regional pain syndromes as well as strengthen an endangered art: the rheumatologic physical examination.