Anjana Saha

Functional IFNG polymorphism in intron 1 in association with an increased risk to promote sporadic breast cancer

Interferon (IFN)-γ is an important Th1 cytokine, which plays a role in immune surveillance and anti-tumor activity. A case-control study involving 54 sporadic breast cancer patients and 144 healthy controls was carried out to explore if the genotype variation of a proposed non-specific enhancer element with a dinucleotide (CA)n repeat in intron 1 has a role in the susceptibility to promote sporadic breast cancer. Genotype analysis carried out by single-strand length polymorphism and confirmed by sequencing showed an increased frequency of (CA)12 allele (P<0.001) and decreased frequencies of (CA)15 (P<0.01) and (CA)>15 (p<0.001) alleles in sporadic breast cancer patients as compared to controls. Further, in vitro reporter assays for (CA)12 and (CA)15 alleles suggested these to be associated with decreased and increased expressions, respectively, suggesting the (CA)12/(CA)12 background to act as one of the factors that could lead to low production of IFN-γ. The study concludes that such genetic background for a proposed non-specific enhancer element with (CA)n repeat within intron 1 of the IFNG gene might put the individuals with this genotype at higher risk to promote the development of sporadic breast cancer due to a resultant compromised immune surveillance.

Human mtDNA hypervariable regions, HVR I and II, hint at deep common maternal founder and subsequent maternal gene flow in Indian population groups

AbstractWe have analysed the hypervariable regions (HVR I and II) of human mitochondrial DNA (mtDNA) in individuals from Uttar Pradesh (UP), Bihar (BI) and Punjab (PUNJ), belonging to the Indo-European linguistic group, and from South India (SI), that have their linguistic roots in Dravidian language. Our analysis revealed the presence of known and novel mutations in both hypervariable regions in the studied population groups. Median joining network analyses based on mtDNA showed extensive overlap in mtDNA lineages despite the extensive cultural and linguistic diversity. MDS plot analysis based on Fst distances suggested increased maternal genetic proximity for the studied population groups compared with other world populations. Mismatch distribution curves, respective neighbour joining trees and other statistical analyses showed that there were significant expansions. The study revealed an ancient common ancestry for the studied population groups, most probably through common founder female lineage(s), and also indicated that human migrations occurred (maybe across and within the Indian subcontinent) even after the initial phase of female migration to India.

Analysis of Indian population based on Y-STRs reveals existence of male gene flow across different language groups.

A study of three different Y-specific microsatellites (Y-STRs) in the populations from Uttar Pradesh (UP), Bihar (BI), Punjab (PUNJ), and Bengal (WB), speaking modern indic dialects with its roots in Indo-Aryan language, and from South of India (SI), speaking the South Indian languages with their root in Dravidian language, has shown that the predominant alleles observed represent the whole range of allelic variation reported in different population groups globally. These results indicate that the Indian population is most diverse. The similarity between the allelic variants between the populations studied by others in Africa and Asia and in this study between WB, PUNJ, UP, BI, and SI are of interest. It demonstrates that these population groups, housed in eight states of the country in different geographic locations, broadly correspond with Indo-Aryan and Dravidian language families. Further, our analyses based on haplotype frequency of different marker loci and gene diversity reveals that none of the population groups have remained isolated from others. High levels of haplotype diversity exist in all the clusters of population. Nonsignificant results based on Markov chain steps and Slatkins linearized genetic distances indicate that there has been migration to and from in these population groups. However, some of the marginally significant interpopulation differences could be attributed to one or more of the castes with high diversity embedded within the population groups studied. Haplotype sharing between populations, F(ST) statistics, and phylogenetic analysis identifies genetic relatedness to be more between individuals belonging to two different states of India, WB and PUNJ, followed by UP and BI, whereas SI branched out separately.

Microsatellite Instability: An Indirect Assay to Detect Defects in the Cellular Mismatch Repair Machinery

The DNA mismatch repair (MMR) pathway plays a prominent role in the correction of errors made during DNA replication and genetic recombination and in the repair of small deletions and loops in DNA. Mismatched nucleotides can occur by replication errors, damage to nucleotide precursors, damage to DNA, or during heteroduplex formation between two homologous DNA molecules in the process of genetic recombination. Defects in MMR can precipitate instability in simple sequence repeats (SSRs), also referred to as microsatellite instability (MSI), which appears to be important in certain types of cancers, both spontaneous and hereditary. Variations in the highly polymorphic alleles of specific microsatellite repeats can be identified using PCR with primers derived from the unique flanking sequences. These PCR products are analyzed on denaturing polyacrylamide gels to resolve differences in allele sizes of >2 bp. Although (CA)n repeats are the most abundant class among dinucleotide SSRs, trinucleotide and tetranucleotide repeats are also frequent. These polymorphic repeats have the advantage of producing band patterns that are easy to analyze and can be used as an indication of a possible MMR defect in a cell. The presumed association between such allelic variation and an MMR defect should be confirmed by molecular analysis of the structure and/or expression of MMR genes.

Promoter and intron‐1 region polymorphisms in the IFNG gene in patients with hepatitis E

Allelic and genotype variations in the promoter region and the dinucleotide (CA)n repeat region in intron 1 of the interferon‐g (IFNG) gene were analysed by direct sequencing and simple sequence length polymorphism (SSLP), respectively, in patients with acute hepatitis, and the prevalence was compared with that in healthy controls. Our results showed a significant association of heterozygous genotypes (CA)12/(CA)14 and (CA)12/(CA)16 in intron 1 of the IFNG gene in all categories of patients with acute hepatitis, classified on the basis of presence or absence of hepatitis E virus (HEV), in comparison with healthy controls. A novel polymorphism, −288 A→T [from the translational start site, as per Human Genome Organization (HUGO) nomenclature], in the promoter region of the IFNG gene leading to a loss of the consensus domain for the interferon‐stimulated response element (ISRE), as predicted by in silico analysis, was observed in 12.5% of patients with acute HEV infection. However, no significant difference in allele or genotype frequency was observed for the −288 promoter polymorphism, although the heterozygous −288 A/T genotype showed a moderate risk in patients with acute HEV infection alone (P = 0.29, odds ratio = 1.964, confidence interval = 0.46–8.45). The data suggest that the genotype at intron 1 of IFNG might affect susceptibility to acute hepatitis in HEV infection, which warrants further elucidation in a larger sample and also functional studies.

Detection of genetic variation in Indian population groups using a novel minisatellite probe and finding relationships through tree construction.

AbstractGenetic variation in HaeIII-digested genomic DNA samples from different individuals belonging to population groups from Bengal, Uttar Pradesh (UP), Punjab, and South India was assessed at hypervariable loci, using a minisatellite probe, pBA1.2 (accession number, AF 157691), the repeat unit of which was 24 mer long and rich in G-bases. Comparison of DNA profiles between individuals showed a very low probability of band sharing, which ranged from 0.18 to 0.24. A dendrogram, based on Neis genetic distance, constructed by the neighbor-joining method, showed the formation of separate clusters by both South Indian and non-Indian samples, whereas the construction of a dendrogram based on the Unweighted pair group method arithmetic average (UPGMA) method with Jaccards similarity coefficient at the individual level led to the formation of several small clusters which were interleaved; also, the subgroups for each of the populations were intermingled with the subgroups for the other populations. A separate analysis was carried out to check the consistency of the proximity between different individuals forming a cluster and between those individuals who were in the vicinity of two clusters. The dendrograms thus obtained did not change the relationship between the individuals from all the populations studied. Despite the distinct clustering observed in the population group comparison, a probable admixture was reflected in the finding that some individuals belonging to one population group were dispersed or embedded within a cluster generated by the individuals of another population group, when a minute dissection of the data for generating a tree at the individual level was carried out.

Novel variations in the signal peptide region of transforming growth factor β1 gene in patients with hepatitis: a brief report from India

Genotypic status of the signal peptide region of transforming growth factor β1 (TGF‐β1) showed a significant difference in C/C‐genotype frequency at +29 position (codon 10) between a range of viral hepatitis patients and controls (P = 0.009, OR = 3.15, CI = 1.29–7.678), contributed by those who were infected with hepatitis B virus (HBV) alone or HBV + hepatitis delta virus (HDV) (P = 0.003, OR = 5.0, CI = 1.78–13.97).

Characterization of a Subcloned Fragment (pBA0.6) of pCMM86 Located on 17q21 and Its Potential Use in Generating an Individual-Specific DNA Profile

Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccards coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator methionine in the pBA0.6 sequence.

Gel-Based Nonradioactive Single-Strand Conformational Polymorphism and Mutation Detection

Single-strand conformation polymorphism (SSCP) for screening mutations/single-nucleotide polymorphisms (SNPs) is a simple, cost-effective technique, saving an expensive exercise of sequencing each and every PCR reaction product and assisting in choosing only the amplicons of interest with expected mutation. The principle of detection of small changes in DNA sequences is based on the changes in single-strand DNA conformations. The changes in electrophoretic mobility that SSCP detects are sequence-dependent. The limitations faced in SSCP range from the routine polyacrylamide gel electrophoresis (PAGE) problems to the problems of resolving mutant DNA bands. Both these problems could be solved by controlling PAGE conditions and by varying physical and environmental conditions such as pH, temperature, voltage, gel type and percentage, addition of additives or denaturants, and others. Despite much upgrading of the technology for mutation detection, SSCP continues to remain the method of choice to analyze mutations and SNPs in order to understand genomic variations, spontaneous and induced, and the genetic basis of diseases.