Ann C. Burgess

Clonal chromosome abnormalities in 54 cases of ovarian carcinoma

As a prelude to assessing the relationship of chromosome alterations to clinical outcome in ovarian carcinoma, we report on the cytogenetic analysis on short-term cultures from 54 patients. All patients had histopathologically confirmed malignancy, with the majority of cases demonstrating serous ovarian adenocarcinomas. Structural alterations were evident in 52 cases, whereas numeric changes were identified in 13 cases. The most notable numeric abnormalities were loss of the X-chromosome (9/13 total cases) and +7 (3/9 diploid cases). Structural alterations most frequently involved chromosomes 1, 3, 6, 7, 11, and 12. Chromosomal breakpoints were shown to cluster in several chromosomal banding regions, including 1p36, 1p11-q21, 3p23-p10, 7p (especially 7p22), 11p, 11q, 12p13-q12, and 12q24. The frequency of structural alterations involving the following chromosome arms was found to be significantly increased: 1p (p < 0.01), 7p (p < 0.01), 11p (p < 0.01), 11q (p < 0.05), and 12p (p < 0.05). An analysis of the net gain or loss of chromosome segments was also performed, with the most consistent tendency observed being over-representation of 1q and chromosome 7, deletion of 1p, and loss of the X chromosome.

Translocation breakpoints in FHIT and FRA3B in both homologs of chromosome 3 in an esophageal adenocarcinoma

Common fragile sites have been proposed to play a mechanistic role in chromosome translocations and other rearrangements in cancer cells in vivo based on their behavior in vitro and their co‐localization with cancer translocation breakpoints. This hypothesis has been the subject of controversy, because associations have been made at the chromosomal level and because of the large number of both fragile sites and cancer chromosome breakpoints. Tests of this hypothesis at the molecular level are now possible with the cloning of common fragile site loci and the use of fragile site clones in the analysis of rearranged chromosomes. FRA3B, the most frequently seen common fragile site, lies within the large FHIT gene. It is now well established that this region is the site of frequent, large intragenic deletions and aberrant transcripts in a number of tumors and tumor cell lines. In contrast, only one tumor‐associated translocation involving the FHIT gene has been reported. We have found translocations in both homologs of chromosome 3 in an early‐passage esophageal adenocarcinoma cell line. This cell line showed no normal FHIT transcripts by reverse transcription polymerase chain reaction. Subsequent chromosome analysis showed translocations of the short arms of both homologs of chromosome 3: t(3;16) and t(3;4). The breakpoints of both translocations were shown by fluorescence in situ hybridization and polymerase chain reaction to be in the FHIT gene, at or near the center of the fragile site region. Using rapid amplification of cDNA ends with FHIT primers, a noncoding chimeric transcript resulting from t(3;16) was identified. These data provide direct support for the hypothesis that FRA3B, and likely other common fragile sites, may be “hot spots” for translocations in certain cancers, as they are for deletions, and that such translocations have the potential to form abnormal chimeric transcripts. In addition, the results suggest selection for loss of a functional FHIT gene by the translocation events.

The canine copper toxicosis locus is not syntenic with ATP7B or ATX1 and maps to a region showing homology to human 2p21.

Canine copper toxicosis (CT) is an autosomal recessive disorder resulting in accumulation of copper at toxic levels in the liver owing to deficient excretion via the bile (Hardy et al. 1975). This disorder is prevalent in certain breeds, most notably the American and British Bedlington Terrier, where disease allele frequencies as high as 0.5 are present, resulting in phenotype frequencies of 25% affected and 50% carriers (Herrtage et al. 1987). Affected dogs develop excessive amounts of copper in their liver and, if untreated, will die of liver disease between 3 and 7 years of age. The gene responsible for canine CT is unknown, but candidates include ATP7B, the gene responsible for Wilson disease in humans (Bull et al. 1993; Tanzi et al. 1993), and the ATX1 (ATOX1 or HAH1) gene, which codes for a copper chaperone that delivers copper to ATP7B within liver cells (Klomp et al. 1997; Hung et al. 1998). Wilson disease in humans is similar to canine CT in that it is also an autosomal recessive disorder where copper accumulates in the liver owing to deficient copper excretion in the biliary system (Brewer and Yuzbasiyan-Gurkan 1992; Bull and Cox 1994). The protein product of ATP7B is a P-type ATPase which is expressed in the liver, kidney, and brain and functions to transport copper in the secretory pathway. Patients with Wilson disease accumulate excess copper primarily in their liver, and over time copper levels in the brain also increase, leading to a movement-type neurological disorder. Thus, the clinical phenotype is similar to canine CT, but differences exist. Neurological manifestations are not seen in canine CT, and affected Wilson disease patients have low levels of ceruloplasmin in their serum, while affected Bedlington terriers have normal levels of serum ceruloplasmin. In addition, the subcellular localization of copper accumulation in the liver differs between affected Wilson disease patients and affected Bedlington terriers. Wilson disease patients accumulate copper in their periportal hepatocytes, while affected Bedlington terriers accumulate copper in the center of the lobules (Owen and Ludwig 1982). HAH1 (ATOX1) (Klomp et al. 1997), the human ortholog of yeast Atx1p, is a cytoplasmic protein that functions as a copper chaperone and is thought to shuttle copper from the cell membrane to both ATP7B and ATP7A (Pufahl et al. 1997) localized in the trans Golgi complex (Dierick et al. 1997; Payne et al. 1998). While not as strong a candidate as the ATP7B gene, it is possible that a mutation in ATX1 could result in liver cirrhosis via interfering with the normal function of ATP7B without affecting the activity of ATP7A. No mammalian disorders have yet been attributed to a mutation in the ATX1 gene. Yuzbasiyan-Gurkan et al. (1997) performed linkage analysis with several Bedlington terrier pedigrees of the American Kennel Club to identify DNA microsatellite marker C04107 as being tightly linked to the CT locus with a LOD score of 5.96 at recombination fraction of zero. This polymorphic marker has been successfully applied in molecular diagnostic tests for CT in Bedlington terriers (Holmes et al. 1998; Ubbink et al. 1998). In an earlier study (Yuzbasiyan-Gurkan et al. 1993), the CT locus was found to be unlinked to the esterase D (ESD) and retinoblastoma (Rb1) loci, both of which show strong linkage to Wilson disease in humans. This suggested that the CT and ATP7B loci were different and unlinked in the dog, but data on linkage of the canine ATP7B, Rb1, and ESD loci is lacking and could differ from that seen in the human genome. In the present study, fluorescent in situ hybridization (FISH) was performed to determine whether candidate genes ATP7B or ATX1 mapped to the same or to different chromosomal locations from C04107. If either ATP7B or ATX1 mapped to the same chromosomal locus as C04107, it would suggest that CT may be a result of a mutation in that gene. If they mapped to different chromosomes, this would strongly support the hypothesis that another gene involved in mammalian copper transport or homeostasis is responsible for canine CT. A canine BAC library constructed from Doberman Pinscher DNA (Roswell Park Cancer Institute, RPCI, Buffalo, N.Y.) was screened with random primed (RediprimeTM II DNA Labeling System, Amersham Life Sciences, Arlington Heights, Ill.) P-labeled probes prepared from PCR products specific for the C04107, ATP7B, and ATX1 loci. PCR primers (forward-58 CCGGATCCTTTAGATGGGAC 38; reverse-58 CAGGTACCCAAGTCATTTGTCTATC 38) designed from sequence upstream of the cytosine-adenine (CA) repeat of microsatellite marker C04107 were used with dog spleen total genomic DNA as template in PCR reactions to generate the CT-specific probe. An ATP7B-specific probe was generated from a PCR reaction using primers (forward58 GACAAAACTGGCACCATACGCACG 38; reverse-58 GTTCTGGAGCTCCTGGACCTTGGCCAG 38) designed from canine exons 14 and 18 and a canine cDNA subclone, which contains ATP7B transmembrane domains 6–8, as template. HAH1 (ATX1) specific primers (forward-58 CAGTCATGCCGAAGCACGAG 38; reverse-58 CTGAGGGTCTCCGCAGGAAC 38) were used with human cDNA as template in a PCR reaction to generate a probe which was used in cross-species hybridization of the canine BAC filters. All PCR products used as probes were checked by sequencing with an Applied Biosystems model 373A automated sequencer. Positive BAC clones were purchased from RPCI and verified as having the correct loci by PCR and Southern blot analysis as well as sequencing. Canine BAC clones 27N21 and 225B1 contain the CA microsatellite C04107 as well as the upstream sequence used to generate the CT-specific probe. Minimally, exons 17 and 18 of the ATP7B gene are contained within BAC clone 243F13, while BAC clone 84B18 contains the ATX1 gene. To map the chromosomal location of these loci, BAC clones Correspondence to: S.L. Dagenais Mammalian Genome 10, 753–756 (1999).

Coverage of chromosome 6 by chromosome microdissection: generation of 14 subregion-specific probes

Human chromosome 6 has been subdivided by chromosome microdissection into 14 unique regions. Following microdissection, polymerase chain reaction (PCR) amplification of dissected DNA was performed using a universal primer to generate subregion-specific probes that provided complete coverage of chromosome 6. All 16 microdissections have been regionally assigned along chromosome 6 by fluorescence in situ hybridization (FISH) using biotin-labeled dissected DNA hybridized to G-banded normal metaphase chromosomes. These probes can be used as region-specific paints to generate unique “bar codes” and for analysis of chromosome alterations involving chromosome 6 that are unidentifiable by conventional banding analysis.

Use of fluorescence in situ hybridization (fish) to study chromosomal damage induced by radiation and bromodeoxyuridine in human colon cancer cells

PURPOSE Although the thymidine analog radiation sensitizer bromodeoxyuridine (BrdUrd) increases radiation-induced chromosomal aberrations, it is not known whether these aberrations are uniformly distributed among chromosomes. Using fluorescence in situ hybridization, we carried out a study to test the hypothesis that BrdUrd-induced radiosensitization may be mediated by nonuniform chromosomal damage. METHODS AND MATERIALS Log phase HT29 human colon cancer cells were exposed to 10 microM BrdUrd (or media alone) for one cell cycle, and the G1 cells were separated by centrifugal elutriation. Half of the control and BrdUrd samples were irradiated with 8 Gy. Cells were then incubated for 24-28 h, and metaphase spreads were prepared. Fluorescence in situ hybridization was performed using paint probes for chromosomes 1 and 4. RESULTS We found that radiation induced 0.20 aberrations per chromosome in chromosome 4. Based on the ratio of the relative lengths of chromosome 1-4 (1.34), it was predicted that chromosome 1 would have approximately 0.26 aberrations per chromosome. However, we observed 0.39 aberrations per chromosome 1, which was significantly greater than the predicted (p < 0.001 by chi-square). Incubation with BrdUrd prior to irradiation significantly increased the aberrations found in chromosome 1 (by a factor of 1.4) and chromosome 4 (by a factor of 1.9) compared to radiation alone (p < 0.001) for both chromosome 1 and 4). CONCLUSION This study demonstrates that individual chromosomes in human colon cancer cells show significantly different rates of aberration after irradiation. Furthermore, the BrdUrd-mediated increase in radiation-induced chromosomal aberrations may not be uniform among chromosomes.

Chromosome breakpoint at 17q11.2 and insertion of DNA from three different chromosomes in a glioblastoma with exceptional glial fibrillary acidic protein expression

A glioblastoma that retained glial fibrillary acidic protein (GFAP) in culture has a break in the long arm of chromosome 17 at band 17q11.2. DNA inserted at this breakpoint came from chromosome bands 3p21, 3q23, 16q11.2, and 22q11.2. These chromosome fragments were inserted in band 17q11.2 proximal to the neurofibromatosis-1 (NF-1) gene and neu (HER2; erbB2) oncogene loci. The glioblastoma also contained a reciprocal translocation between 16p12 and 20p12. These structural abnormalities, previously undescribed in gliomas, were demonstrated by high-resolution chromosome banding, microdissection, and fluorescence in situ hybridization (FISH). Numerical changes typical of glioblastoma were present: gain of chromosome 7 and losses of chromosomes 10, 13, and 22. The complex chromosome origin of DNA inserted in this glioma chromosome is described. The association of two infrequent events in this single glioblastoma line, this complex insertion and retention of GFAP expression, is not likely to be a chance occurrence. It raises the possibility of an association between the two events.

Generation and molecular cytogenetic characterization of a radiation-reduction hybrid panel for human chromosome 6

A neoR marked chromosome-6 containing hybrid (D113JA) was used to generate a panel of 15 radiation-reduced hybrid cell lines. The panel was constructed by irradiating microcells isolated from D113JA at 800 or 8000 rads, providing different levels of chromosome 6 retention. These hybrids have been systematically analyzed using interspersed repetitive elements, previously assigned markers for chromosome 6, and fluorescent in situ hybridization (FISH). As expected, G418 selection has favored the retention of fragments near the insertion site of the neoR gene (6q16). The panel as constituted provides an important resource for regional assignment of molecular markers, especially to regions on 6q.