Anouk Oldenburger

Anti-Inflammatory Role of the cAMP Effectors Epac and PKA: Implications in Chronic Obstructive Pulmonary Disease

Cigarette smoke-induced release of pro-inflammatory cytokines including interleukin-8 (IL-8) from inflammatory as well as structural cells in the airways, including airway smooth muscle (ASM) cells, may contribute to the development of chronic obstructive pulmonary disease (COPD). Despite the wide use of pharmacological treatment aimed at increasing intracellular levels of the endogenous suppressor cyclic AMP (cAMP), little is known about its exact mechanism of action. We report here that next to the β2-agonist fenoterol, direct and specific activation of either exchange protein directly activated by cAMP (Epac) or protein kinase A (PKA) reduced cigarette smoke extract (CSE)-induced IL-8 mRNA expression and protein release by human ASM cells. CSE-induced IκBα-degradation and p65 nuclear translocation, processes that were primarily reversed by Epac activation. Further, CSE increased extracellular signal-regulated kinase (ERK) phosphorylation, which was selectively reduced by PKA activation. CSE decreased Epac1 expression, but did not affect Epac2 and PKA expression. Importantly, Epac1 expression was also reduced in lung tissue from COPD patients. In conclusion, Epac and PKA decrease CSE-induced IL-8 release by human ASM cells via inhibition of NF-κB and ERK, respectively, pointing at these cAMP effectors as potential targets for anti-inflammatory therapy in COPD. However, cigarette smoke exposure may reduce anti-inflammatory effects of cAMP elevating agents via down-regulation of Epac1.

A-kinase anchoring proteins contribute to loss of E-cadherin and bronchial epithelial barrier by cigarette smoke

Airway epithelium, which forms the first barrier towards environmental insults, is disturbed by cigarette smoking, a major risk factor for developing chronic obstructive pulmonary disease (COPD). A-kinase anchoring proteins (AKAP) maintain endothelial barrier function and coordinate subcellular localization of protein kinase A (PKA). However, the role of AKAPs in epithelial barrier function is unknown. We studied the role of AKAPs in regulating human bronchial epithelial (Hogg JC, Timens W. Annu Rev Pathol 4: 435-459, 2009; HBE) barrier. Cigarette smoke extract (CSE) reduced barrier function in 16HBE cells and the expression of the adhesion molecule E-cadherin specifically at the cell membrane. In addition, CSE reduced the protein expression of the AKAP family member AKAP9 at the cell membrane. The expression of AKAP5 and AKAP12 was unaffected by CSE. AKAP9 interacted and colocalized with E-cadherin at the cell membrane, suggesting that the reduction of both proteins may be related. Interestingly, disruption of AKAP-PKA interactions by st-Ht31 prevented the CSE-induced reduction of E-cadherin and AKAP9 protein expression and subsequent loss of barrier function. Silencing of AKAP9 reduced the functional epithelial barrier and prevented the ability of st-Ht31 to restore membrane localization of E-cadherin. Our data suggest the possibility of a specific role for AKAP9 in the maintenance of the epithelial barrier. E-cadherin, but not AKAP9, protein expression was reduced in lung tissue from COPD patients compared with controls. However, AKAP9 mRNA expression was decreased in primary bronchial epithelial cells from current smokers compared with non/ex-smokers. In conclusion, our results indicate that AKAP proteins, most likely AKAP9, maintain the bronchial epithelial barrier by regulating the E-cadherin expression at the cell membrane.

Multiple Facets of cAMP Signalling and Physiological Impact: cAMP Compartmentalization in the Lung

Therapies involving elevation of the endogenous suppressor cyclic AMP (cAMP) are currently used in the treatment of several chronic inflammatory disorders, including chronic obstructive pulmonary disease (COPD). Characteristics of COPD are airway obstruction, airway inflammation and airway remodelling, processes encompassed by increased airway smooth muscle mass, epithelial changes, goblet cell and submucosal gland hyperplasia. In addition to inflammatory cells, airway smooth muscle cells and (myo)fibroblasts, epithelial cells underpin a variety of key responses in the airways such as inflammatory cytokine release, airway remodelling, mucus hypersecretion and airway barrier function. Cigarette smoke, being next to environmental pollution the main cause of COPD, is believed to cause epithelial hyperpermeability by disrupting the barrier function. Here we will focus on the most recent progress on compartmentalized signalling by cAMP. In addition to G protein-coupled receptors, adenylyl cyclases, cAMP-specific phospho-diesterases (PDEs) maintain compartmentalized cAMP signalling. Intriguingly, spatially discrete cAMP-sensing signalling complexes seem also to involve distinct members of the A-kinase anchoring (AKAP) superfamily and IQ motif containing GTPase activating protein (IQGAPs). In this review, we will highlight the interaction between cAMP and the epithelial barrier to retain proper lung function and to alleviate COPD symptoms and focus on the possible molecular mechanisms involved in this process. Future studies should include the development of cAMP-sensing multiprotein complex specific disruptors and/or stabilizers to orchestrate cellular functions. Compartmentalized cAMP signalling regulates important cellular processes in the lung and may serve as a therapeutic target.

Interaction between Epac1 and miRNA-7 in airway smooth muscle cells

Chronic obstructive pulmonary disease (COPD) is an inflammatory disorder of structural airway cells with cigarette smoke as the main etiologic factor. COPD patients are treated with agonists of the β2-adrenoceptor, which induce their biological effects by elevating cyclic AMP and subsequently activate protein kinase A (PKA) and the “exchange proteins directly activated by cAMP”, Epac1 and Epac2. PKA and Epac are involved in key processes that contribute to the pathogenesis of COPD, including inflammation (Schmidt et al. 2013). The expression of specifically Epac1 protein is reduced in cultured human airway smooth muscle (HASM) cells, immortalized by stable ectopic expression of human telomerase reverse transcriptase enzyme, after exposure to cigarette smoke extract (CSE) and in lung tissue from COPD patients (Oldenburger et al. 2012). Since specific activation of Epac reduces CSEinduced cytokine release (Oldenburger et al. 2012), loss of Epac1 may contribute to the inflammatory process in COPD. MicroRNAs (miRNAs) are epigenetic regulators involved in fine-tuning of cellular activities by posttranscriptional repression of mRNA. In COPD, miRNAs have been implicated in the regulation of inflammatory processes (Oglesby et al. 2010), and miRNA-7 is increased in serum of COPD patients (Akbas et al. 2013). In silico analysis indicates that Epac1 is a putative target of miRNA-7 (targetscan.org). Therefore, we hypothesized that increased miRNA-7 levels are involved in the attenuation of Epac1 expression in COPD patients. We investigated the expression of Epac and miRNA-7 in lung tissue of control and COPD patients as well as in CSEexposed structural airway cells. HASM cells, MRC-5 fibroblasts, and human bronchial epithelial (16HBE14o-) cells were exposed to CSE as described previously (Oldenburger et al. 2012). RT-PCR for miRNA-7 was performed by using stemloop primers (Stemloop: GTCGTATCCAGTGCAGGGTCCGAGGTAT TGCGCACTGGATACGACACAACAAA; Forward: GCGGTTGGAAGACTAGTGAT; Reverse: CCAGTGCA GGGTCCGAGGTCCG) and quantified results were normalized to RNU6B (Stemloop: GTCGTATCCAGTGCAGGGTC CGAGGTATTCGCACTGGATACGACAAAAATATGG; Forward: TGCGGCTGCGCAAGGATGA; Reverse: CCAG TGCAGGGTCCGAGGTCCG). CSE increased miRNA-7 expression specifically in HASM cells, leaving miRNA-7 in 16HBE14oand MRC-5 cells unaffected (Fig. 1a). To correlate the expression of miRNA7 and Epac1, HASM cells were lentivirally transformed to overexpress miRNA-7. Although Epac2 protein (Fig. 1c) was not altered, ectopic overexpression of miRNA7 significantly decrease Epac1 protein (Fig. 1b; p=0.03). These data suggest that Epac1 is targeted by miRNA-7 and that increased miRNA-7 expression is related to CSE-induced downregulation of Epac1 in HASM. Wim Timens and Martina Schmidt shared senior authorship. A. Oldenburger : B. van Basten :H. Meurs :M. Schmidt Department of Molecular Pharmacology, University of Groningen, Groningen, The Netherlands