Bai-Rong Li

Risk factors for complications of pancreatic extracorporeal shock wave lithotripsy

BACKGROUND AND STUDY AIMS Extracorporeal shock wave lithotripsy is recommended as treatment for stones in chronic pancreatitis. The aim of this study was to investigate the risk factors for complications of pancreatic extracorporeal shock wave lithotripsy (P-ESWL). PATIENTS AND METHODS Patients with painful chronic pancreatitis and pancreatic stones (> 5 mm diameter) who were treated with P-ESWL between March 2011 and June 2013 were prospectively included. Adverse events after P-ESWL were classified as complications and transient adverse events, depending on severity. The major complications of P-ESWL included post-ESWL pancreatitis, bleeding, infection, steinstrasse, and perforation. Multivariate analyses based on univariate analysis were performed to detect risk factors of overall and moderate-to-severe complications. RESULTS A total of 634 patients underwent 1470 P-ESWL procedures. The overall complication rate was 6.7 % of all procedures. Complications occurred in 62 patients (9.8 %) after the first ESWL procedure. The risk factors for complications were pancreas divisum (odds ratio [OR] 1.28) and the interval between diagnosis of chronic pancreatitis and P-ESWL (OR 1.28). Protective factors were male sex (OR 0.50), diabetes (OR 0.45), and steatorrhea (OR 0.43). Male sex, the only identified predictor for moderate-to-severe complications, was a protective factor (OR 0.19). For the second P-ESWL procedure, complications occurred in 22/409 patients (5.4 %). Complication and asymptomatic hyperamylasemia after the first ESWL session were significantly associated with higher risk for complications after the second ESWL session (P < 0.05). CONCLUSIONS Patient-related factors were important in determining a high risk of P-ESWL complications when no procedure-related factors were identified. Patients suffering from complications after the first ESWL session were also likely to experience complications in subsequent P-ESWL sessions.

Risk Factors for Diabetes Mellitus in Chronic Pancreatitis: A Cohort of 2011 Patients

AbstractDiabetes mellitus (DM) is a common complication of chronic pancreatitis (CP) and increases the mortality. The identification of risk factors for DM development may contribute to the early detection and potential risk reduction of DM in patients with CP.Patients with CP admitted to Changhai Hospital (Shanghai, China) from January 2000 to December 2013 were enrolled. Cumulative rates of DM after the onset of CP were calculated by Kaplan-Meier method. Risk factors for DM development after the diagnosis of CP were identified by Cox proportional hazards regression model.A total of 2011 patients with CP were enrolled. During follow-up (median duration, 22.0 years), 564 patients developed DM. Cumulative rates of DM 20 and 50 years after the onset of CP were 45.8% (95% confidence interval [CI], 41.8%–50.0%) and 90.0% (95% CI, 75.4%–97.7%), respectively. Five risk factors for DM development after the diagnosis of CP were identified: male sex (hazard ratio [HR], 1.51; 95% CI, 1.08–2.11), alcohol abuse (HR, 2.00; 95% CI, 1.43–2.79), steatorrhea (HR, 1.46; 95% CI, 1.01–2.11), biliary stricture (HR, 2.25; 95% CI, 1.43–3.52), and distal pancreatectomy (HR, 3.41; 95% CI, 1.80–6.44).In conclusion, the risk of developing DM in patients with CP is not only influenced by the development of biliary stricture and steatorrhea indicating disease progression, and inherent nature of study subjects such as male sex, but also by modifiable factors including alcohol abuse and distal pancreatectomy .

Chronic pancreatitis and pancreatic cancer.

Background: Pancreatic cancer (PC) is one of the most lethal diseases with an incidence rate almost equal to the rate of mortality. Chronic pancreatitis (CP) is a common chronic inflammatory disease of unknown etiology that affects the pancreas. Epidemiological studies have identified CP to be a major risk factor for PC. Summary: A greater understanding of the molecular mechanisms linking CP and PC has identified several common pathways that provide targets for future interventions. This article reviews those components in the CP-PC connection, including the role of macrophages, the maintenance of genome stability, cytokines, and other nodal factors such as nuclear factor kappa B, COX-2 and reactive oxygen species. Key Message: The molecular mechanisms that underlie CP and PC provide novel targets for future therapies for PC. Practical Implications: The stromal-desmoplastic reaction plays an important role in initiating and sustaining chronic inflammation and tumor progression. Recently, two targeted anti-tumor agents, erlotinib and nab-paclitaxel, have shown promising therapeutic efficacy. Notably, both these agents target components (EGFR and SPARC) within the inflammatory stroma surrounding malignant cells, underscoring the importance of inflammation in pancreatic carcinogenesis. Identifying the common pathways linking CP and PC may help uncover additional novel targets for future therapies.

Risk Factors for Steatorrhea in Chronic Pancreatitis: A Cohort of 2,153 Patients.

This study aimed to investigate the occurrence of and determine the risk factors for steatorrhea in chronic pancreatitis (CP). It was based on analysis of both retrospectively and prospectively acquired database for CP patients admitted to our center from January 2000 to December 2013. Demographic data, course of disease, medical history, and follow-up evaluations of patients were documented in detail. Cumulative rate of steatorrhea was calculated by using the Kaplan–Meier method. For risk factor analysis, multivariate analysis by Cox proportional hazards regression model was performed. A total of 2,153 CP patients were included with a mean follow-up duration of 9.3 years. Approximately 14% (291/2,153) of CP patients presented with steatorrhea at diagnosis of CP. Cumulative rates of steatorrhea at 1, 5, 10, and 20 years after diagnosis of CP were 4.27% (95% CI: 3.42%–5.34%), 12.53% (95% CI: 10.74%–14.59%), 20.44% (95% CI: 17.37%–23.98%) and 30.82% (95% CI: 20.20%–45.21%), respectively. Male gender (HR = 1.771, p = 0.004), diabetes (HR = 1.923, p < 0.001), alcohol abuse (HR = 1.503, p = 0.025) and pancreaticoduodenectomy (HR = 2.901, p < 0.001) were independent risk factors for steatorrhea while CP in adolescents (HR = 0.433, p = 0.009) was a protective factor. In conclusion, male gender, adult, diabetes, alcohol abuse and pancreaticoduodenectomy lead to increased risk of steatorrhea in CP patients.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient

BackgroundPeutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer.Case presentationWe reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members’. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people.ConclusionsThe novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

Incidence of and risk factors for pancreatic cancer in chronic pancreatitis: A cohort of 1656 patients

BACKGROUND Risk of pancreatic cancer may increase in chronic pancreatitis patients. AIMS This study aimed to identify the incidence of and risk factors for pancreatic cancer in chronic pancreatitis patients. METHODS Chronic pancreatitis patients admitted to our center from January 2000 to December 2013 were enrolled. Cumulative rates of pancreatic cancer and survival rates were calculated. The standardized incidence ratio was calculated based on the pancreatic cancer incidence in general population of China. Risk factors for pancreatic cancer were identified. RESULTS In a total of 1656 patients, the median follow-up duration was 8.0 years. Pancreatic cancer was detected in 21 patients (1.3%). The expected number of cases of pancreatic cancer was 1.039, yielding a standardized incidence ratio of 20.22. The standardized incidence ratios for patients with a >60 pack-year smoking history were much higher (145.82). Two risk factors for pancreatic cancer were identified: age at the onset of chronic pancreatitis (hazard ratio, 1.05) and a >60 pack-year smoking history (hazard ratio, 11.83). CONCLUSION The risk of pancreatic cancer is markedly increased in chronic pancreatitis patients compared with the general population, especially in patients with an older age at onset and a >60 pack-year smoking history. The high-risk populations were suggested to be followed up closely.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz–Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History

Background and AimsPeutz–Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies.Methods and ResultsWe treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426–448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain.ConclusionsThe results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Risk Factors and Nomogram for Pancreatic Pseudocysts in Chronic Pancreatitis: A Cohort of 1,998 Patients

Pancreatic pseudocyst is a common complication of chronic pancreatitis. The identification of risk factors and development of a nomogram for pancreatic pseudocysts in chronic pancreatitis patients may contribute to the early diagnosis and intervention of pancreatic pseudocysts.

Extracorporeal shock wave lithotripsy is safe and effective for pediatric patients with chronic pancreatitis

Background and aims Pancreatic extracorporeal shock wave lithotripsy (P-ESWL) is recommended as the first-line treatment for pancreatic stones. However, how well P-ESWL performs in pediatric patients remains unclear. We aimed to evaluate the safety and efficacy of P-ESWL for pediatric patients with chronic pancreatitis. Methods This prospective observational study was conducted in patients with painful chronic pancreatitis who underwent P-ESWL. Patients aged under 18 years were included in the pediatric group; patients aged over 18 years who underwent P-ESWL in the same period were assigned to the control group. For investigation of long-term follow-up, the pediatric group were matched with patients from the control group in a 1:1 ratio. The primary outcomes were P-ESWL complications and pain relief. The secondary outcomes included: stone clearance, physical and mental health, quality of life score, and growth and developmental state. Results From March 2011 to March 2015, P-ESWL was performed in 1135 patients (72 in the pediatric group, 1063 in the control group). No significant differences were observed in the occurrence of P-ESWL complications between the two groups (11.1 % vs. 12.8 %; P = 0.68). Among the 67 pediatric patients (93.1 %) who underwent follow-up for 3.0 years (range 1.3 - 5.2), complete pain relief was achieved in 52 patients (52 /67; 77.6 %); this value was not significantly different from that of the matched controls (55 /69; 79.7 %; P = 0.94). Conclusions P-ESWL is safe and effective for pediatric patients with chronic pancreatitis. It can promote significant pain relief and stone clearance, and can benefit growth and development.

Cancer risk in patients with Peutz–Jeghers syndrome: A retrospective cohort study of 336 cases

Peutz–Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz–Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz–Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21–67). The relative risk for cancer in Peutz–Jeghers syndrome patients was 63.858 (confidence interval: 47.514–85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz–Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417–366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas (p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found (p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.