Birgitta Winnepenninckx

18S RRNA SUGGESTS THAT ENTOPROCTA ARE PROTOSTOMES, UNRELATED TO ECTOPROCTA

The Ento- and Ectoprocta are sometimes placed together in the Bryozoa, which have variously been regarded as proto- or deuterostomes. However, Entoprocta have also been allied to the pseudocoelomates, while Ectoprocta are often united with the Brachiopoda and Phoronida in the (super)phylum Lophophorata. Hence, the phylogenetic relationships of these taxa are still much debated. We determined complete 18S rRNA sequences of two entoprocts, an ectoproct, an inarticulate brachiopod, a phoronid, two annelids, and a platyhelminth. Phylogenetic analyses of these data show that (1) entoprocts and lophophorates have spiralian, protostomous affinities, (2) Ento- and Ectoprocta are not sister taxa, (3) phoronids and brachiopods form a monophyletic clade, and (4) neither Ectoprocta or Annelida appear to be monophyletic. Both deuterostomous and pseudocoelomate features may have arisen at least two times in evolutionary history. These results advocate a Spiralia-Radialia-based classification rather than one based on the Protostomia-Deuterostomia concept.

Random amplified polymorphic DNA (RAPD) and parsimony methods

Abstract Random amplified polymorphic DNA (RAPD) data possess a number of undesirable features for parsimony analysis. These features include their non-codominant inheritance, their anonymous nature, their different (a)symmetrical transformation probabilities, and their possible GC priming bias. As a consequence, no single parsimony method seems appropriate for RAPD data. Moreover, the presence/absence coding of RAPDs is equivalent to the invalid independent allele model for allozymes. These issues are discussed and the way in which parsimony analysis of RAPDs can be misleading is illustrated.

The Reduced Expression of the HADH2 Protein Causes X-Linked Mental Retardation, Choreoathetosis, and Abnormal Behavior

Recently, we defined a new syndromic form of X-linked mental retardation in a 4-generation family with a unique clinical phenotype characterized by mild mental retardation, choreoathetosis, and abnormal behavior (MRXS10). Linkage analysis in this family revealed a candidate region of 13.4 Mb between markers DXS1201 and DXS991 on Xp11; therefore, mutation analysis was performed by direct sequencing in most of the 135 annotated genes located in the region. The gene (HADH2) encoding L-3-hydroxyacyl-CoA dehydrogenase II displayed a sequence alteration (c.574 C-->A; p.R192R) in all patients and carrier females that was absent in unaffected male family members and could not be found in 2,500 control X chromosomes, including in those of 500 healthy males. The silent C-->A substitution is located in exon 5 and was shown by western blot to reduce the amount of HADH2 protein by 60%-70% in the patient. Quantitative in vivo and in vitro expression studies revealed a ratio of splicing transcript amounts different from those normally seen in controls. Apparently, the reduced expression of the wild-type fragment, which results in the decreased protein expression, rather than the increased amount of aberrant splicing fragments of the HADH2 gene, is pathogenic. Our data therefore strongly suggest that reduced expression of the HADH2 protein causes MRXS10, a phenotype different from that caused by 2-methyl-3-hydroxybutyryl-CoA dehydrogenase deficiency, which is a neurodegenerative disorder caused by missense mutations in this multifunctional protein.

A splice site mutation in the methyltransferase gene FTSJ1 in Xp11.23 is associated with non-syndromic mental retardation in a large Belgian family (MRX9)

Mental retardation is the most frequent cause of serious handicap in children and young adults. The underlying causes of this heterogeneous condition are both acquired and genetically based. A recently performed refinement of the linkage interval in a large Belgian family with mild to severe non-syndromic X linked mental retardation, classified as MRX9, revealed a candidate region of 11.3 Mb between markers DXS228 and DXS1204 on the short arm of the X chromosome. In order to identify the underlying disease gene in the MRX9 family, we established a gene catalogue for the candidate region and performed comprehensive mutation analysis by direct sequencing. A human homologue of the bacterial 23S rRNA methyltransferase Fstj, the FTSJ1 gene, is located within this region and displayed a sequence alteration in the conserved acceptor splice site of intron 3 (IVS3-2A>G) in all tested patients and carrier females of this family. In contrast, it was absent in all unaffected male family members tested. The mutation results in skipping of exon 4 and introduces a premature stop codon in exon 5, probably leading to a severely truncated protein. Our finding indicates that a protein, possibly associated with ribosomal stability, can be linked to X linked mental retardation (XLMR).

The molecular basis of the folate-sensitive fragile site FRA11A at 11q13

We report on the molecular basis of the rare, folate-sensitive fragile site FRA11A in chromosome band 11q13 in a family with cytogenetic expression. Five individuals express the fragile site and one was mentally retarded. Expansion of a polymorphic CGG-repeat located at the 5′ end of the C11orf80 gene causes FRA11A. The CGG-repeat elongation coincides with hypermethylation of the adjacent CpG island and subsequent transcriptional silencing of the C11orf80 gene. This gene has no homology with known genes. A relationship between cytogenetic expression of the fragile site and the mental handicap seems unlikely, as FRA11A was found in a mentally retarded patient as well as in phenotypically normal carriers from the same family. However, incomplete penetrance cannot be entirely excluded.

Beckwith-Wiedemann-Like Macroglossia and 18q23 Haploinsufficiency

Beckwith–Wiedemann syndrome (BWS) is an overgrowth condition with tumor proclivity linked to a genetic imbalance of a complex imprinted region in 11p15.5. A female child with features fitting in with the BWS diagnostic framework and an apparent loss of imprinting (LOI) of the IGF2 gene in 11p15.5 was also reported to have a de novo chromosome 18q segmental deletion (Patient 1), thus pointing at the location of a possible trans‐activating regulator element for maintenance of IGF2 imprinting and providing one of the few examples of locus heterogeneity of BWS. A second child with de novo 18q23 deletion and features of macroglossia, nævus flammeus, bilateral inguinal hernia and transient neonatal hypoglycemia, thus also fitting in with the BWS diagnostic framework, is here fully reported (Patient 2). In this child, an analysis of the BWS1 locus precluded any paternal isodisomy and showed a normal imprinting pattern (mono‐allelic expression of IGF2 and normal H19 and CDKN1OT1/LIT1 methylation index). In Patients 1 and 2, deletions were shown to overlap, defining a minimal region of haplo‐insufficiency of 3.8–5.6 Mb in 18q23. We conclude that this region provides a candidate location for an original macroglossia condition with strong overlap with BWS, but without obvious upstream functional relationship with the BWS1 locus in 11p15.5. Because this minimal region of haplo‐insufficiency falls into a common region of deletion in 18q– syndrome, we inferred that this macroglossia condition would follow a recessive pattern of inheritance.

A missense mutation in the coiled-coil motif of the HP1-interacting domain of ATR-X in a family with X-linked mental retardation

The ATR-X syndrome (MIM *301040) is an X-linked form of mental retardation (XLMR) characterized by mental retardation, typical facial dysmorphism, skeletal abnormalities, a-thalassemia, and genital malformations ranging from hypospadia to male pseudohermaphroditism. Mutations in the ATR-X / XNP gene on Xq13.3 were identified in families with typical ATR-X [1]. More recently, the ATR-X gene has been shown to be involved in other XLMR syndromes [1]. Obligate carrier females are generally unaffected and show a marked skewed pattern of X inactivation [2]. The ATR-X gene consists of 35 exons encoding a nuclear protein of the SWI/SNF chromatin remodeling protein family [3, 4]. Most of the mutations are located within exons 7–9 encoding a zinc finger PHD-like domain and in exons 18–35 encoding the highly conserved helicase domains and the carboxy terminal region [1]. Recently, ATR-X mutations outside these mutation hot spots have been detected in families with mild-to-moderate mental retardation without the characteristic ATR-X phenotype [5]. We report the first missense mutation in the coiled-coil motif of the heterochromatin protein 1 (HP1) interacting domain of ATR-X in a family with X-linked mental retardation. The index patient V-1 (Fig. 1a) is a 14-year-old boy of healthy parents affected by mental retardation and behavioral disturbance. He is barely able to speak, but has some ability to read and write. Facial dysmorphy includes hypertelorism, slight ptosis, broad nasal bridge, macroglossia, retrognathia, and an everted lower lip. He has short fingers and simian creases on both hands. IV-6 is also mentally retarded and exhibited aggressive behavior during adolescence. He is able to speak, but in a dysgrammatical manner (IQ according to Binet-Kramer 0.41) and developed no reading and writing skills. IV-14 and V6 are also mentally retarded. IV-9 has a learning disability, but finished school. Haplotype analysis using STRs included the ATR-X / XNP gene as a candidate gene. Furthermore, a skewed X-inactivation pattern was observed in carrier females IV-3, IV-11, and III-7. Sequencing of the ATR-X gene revealed missense mutation c1226T>C (reference sequence NM_000489) in exon 9 (Fig. 1b). This missense mutation has not been recorded in the databases (HGMD, dbSNP). DNA from normal blood donors and from family members was analyzed by PCR using primers 5’GAGACCACAGCCAACAT3’ and 5’CTATGACTTTATGCTCTTTGGT3’ from exon 9 of the ATR-X gene followed by digestion of the PCR products by Sfa N1 (New England BioLabs) (Fig. 1b). The c1226T>C mutation was not detected in 125 random DNA samples from 75 females and 50 males. Mutation c1226T>C in codon 409 replaces Leu by Ser (L409S) in the HP1-interacting domain of the ATR-X protein. When analyzing the normal ATR-X amino acid sequence with the computer program Plotstructure (GCG Electronic database information. The URL for data presented are as follows: Online Mendelian Inheritance in Man (OMIM) http:// www.ncbi.nlm.nih.gov/Omim; GenBank http://www.ncbi.nlm. nih.gov/Genbank; The Human Gene Mutation Database (HGMD) http://archive.uwcm.ac.uk; NCBI Molecular Variation Database (dbSNP) http://www.ncbi.nlm.nih.gov/SNP.