Bruce C. Ross

A Massive Epidemic of Multidrug-Resistant Typhoid Fever in Tajikistan Associated with Consumption of Municipal Water

From 1 January through 30 June 1997, 8901 cases of typhoid fever and 95 associated deaths were reported in Dushanbe, Tajikistan. Of 29 Salmonella serotype Typhi isolates tested, 27 (93%) were resistant to ampicillin, chloramphenicol, nalidixic acid, streptomycin, sulfisoxazole, tetracycline, and trimethoprim-sulfamethoxazole. In a case-control study of 45 patients and 123 controls, Salmonella Typhi infection was associated with drinking unboiled water (matched odds ratio, 7; 95% confidence interval, 3-24; P<.001). Of tap water samples, 97% showed fecal coliform contamination (mean level, 175 cfu/100 mL). Samples taken from water treatment plants revealed that fecal coliform contamination occurred both before and after treatment. Lack of chlorination, equipment failure, and back-siphonage in the water distribution system led to contamination of drinking water. After chlorination and coagulation were begun at the treatment plants and a water conservation campaign was initiated to improve water pressure, the incidence of typhoid fever declined dramatically.

Genotype and phenotype of oral Candida albicans from patients infected with the human immunodeficiency virus.

Candida albicans has been shown to vary in its phenotypic expression with the progression of human immunodeficiency virus (HIV) infection. Isolates of C. albicans were obtained from 45 patients with HIV infection during the progression of their disease and differentiated using two methods. The first utilized the morphological characteristics of colonies, and the second method utilized a small portion of C. albicans DNA as a probe on Southern-transferred, EcoRI-digested C. albicans genomic DNA. In 67% of the patients a single strain of C. albicans, as determined by the DNA analysis, was isolated from each individual. The phenotypic expression of the genetically identical strains varied considerably over the experimental period with one morphotype being predominant. These results showed that the genotype of C. albicans persisted in the majority of HIV-infected individuals, but that the phenotypical expression of this strain changed. A novel finding in this study was that 18 strains of C. albicans had DNA which did not hybridize to the probe used.

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients

&NA; Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102‐E 5′ GATGGCTGTTTCCAAGCCCA 3′ and pAZ102‐H 5′ GTGTACGTTGCAAAGTACTC 3′ from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base‐pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a nonresolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

Characterization of hepatitis A virus capsid proteins with antisera raised to recombinant antigens

The capsid proteins of hepatitis A virus (HAV) were expressed as fusion proteins of beta-galactosidase in E. coli using the expression vector lambda gt11. Four fusion proteins were stably expressed and used to immunize rabbits to obtain mono-specific antisera. The antisera were unable to neutralize viral infectivity or react with HAV by radioimmunoassay. Three of the antisera were able to recognize HAV antigens in infected BS-C-1 cells by immunofluorescence and denatured capsid proteins by immunoblot analysis. The antisera were used to investigate the migration of the capsid proteins in gels by immunoblot analysis using standard SDS-PAGE conditions and in gels containing urea. The migration of VP1 and VP3 correlated with their molecular weights predicted from the nucleotide sequence and was consistent in either the presence or absence of urea. However, VP2 migrated with an apparent molecular weight significantly higher than the predicted value and, in gels containing urea, migrated as a doublet. It is proposed that the upper band of this doublet represents VP0, the proteolytic precursor of VP2 and VP4. The relative molecular mass (Mr) of VP4 was estimated to be less than 1 kDa, which is substantially lower than the 2.5 kDa predicted from the nucleotide sequence.

THE DIAGNOSTIC USE OF THE POLYMERASE CHAIN REACTION FOR THE DETECTION OF MYCOBACTERIUM TUBERCULOSIS

&NA; Detection of Mycobacterium tuberculosis by microscopy is difficult in specimens containing fewer than 104 bacteria/mL and growth in culture can take up to 6 wks. In this study the Polymerase Chain Reaction (PCR) was investigated as a rapid diagnostic technique for the detection of M. tuberculosis. The presence of DNA polymerase inhibitors in sputum specimens poses a potentially serious problem as false negative results can occur. In this study polymerase inhibitors were detected by inclusion of an internal plasmid control in each test. DNA from specimens in which the internal control failed to amplify was purified with a DNA binding matrix before retesting by PCR. A total of 169 sputum specimens were examined and 4 were found to have inhibitors. The correlation between detection of M. tuberculosis by PCR with a combination of culture, Ziehl‐Neelsen (ZN) staining and patient history was 97.6%. This study confirms that PCR offers a more sensitive and rapid alternative for the detection of M. tuberculosis to ZN staining and culture, with results being available within 24 hrs of a specimen being received in the laboratory.

Genetic differentiation of Candida albicans strains by mixed-linker polymerase chain reaction

Restriction fragment length polymorphisms (RFLPs) of C. albicans were visualized using a mixed-linker polymerase chain reaction (PCR) and a C. albicans-specific primer (C. albicans 1059-bp species-specific repeat sequence). The method produced 10-14 bands of between 200 and 1400 bp on agarose gel electrophoresis and ethidium bromide staining. It gave comparable results to Southern blot hybridization with good reproducibility and the time required for the production of typing profiles was reduced to less than 2 days.

Rapid detection and molecular characterization of australian human rickettsial isolates

Australia has a number of unique rickettsial diseases including Queensland Tick Typhus. More recently, Flinders Island Spotted Fever ( FISF ) of presumed rickettsial origin has been described. We have studied Australian human rickettsial disease from 2 perspectives. Firstly, we have detected rickettsial DNA in blood samples of 2 patients with FISF by DNA amplification utilizing the Polymerase Chain Reaction. Confirmation of the rickettsial origin of the amplified DNA was made by hybridization with a rickettsia-specific DNA probe. This probe, made from the genus-common 17 kilodalton antigen of Rickettsia australis has been fully characterised and incorporates non-radioactive detection of target molecules. We aim to develop this method to provide rapid diagnosis of rickettsial disease Secondly, by applying the molecular typing technique of ribosomal DNA hybridization we have investigated the DNA relatedness of Australian human rickettsial isolates from Queensland Tick Typhus and presumptive human rickettsial isolates from FISF. Digestion of purified rickettsial chromosomal DNA from human isolates with the restriction endonuclease Eco R1 revealed specific differences between rickettsial isolates from patients with Queensland Tick Typhus and FISF when probed with ribosomal DNA. Ongoing studies are in progress to establish the relatedness of these isolates.