Chantal Faure

Association of Little cherry virus 1 (LChV1) with the Shirofugen Stunt Disease and Characterization of the Genome of a Divergent LChV1 Isolate

Double-stranded RNAs purified from the V2356 (Successa) sour cherry source of the Shirofugen stunt disease (SSD) were sequenced using a 454 pyrosequencing multiplex approach. The 15,646 reads obtained were assembled into 279 contigs, 5 of which, totaling almost 16.9 kbp and 5,332 reads (34% of sample reads), showed high Blast scores and homology to Little cherry virus 1 (LChV1). The five contigs were further assembled manually into three supercontigs spanning the full LChV1 genome with only two small gaps (17 and 55 bases). Completion of the sequencing of the viral genome was performed using targeted polymerase chain reaction and primers designed from the contigs. No evidence for the presence of other viral agents in the V2356 source could be obtained in the remaining contigs or singletons. The V2356 LChV1 isolate is only ≈76% identical with the reference complete LChV1 sequences and, in particular, with the ITMAR isolate associated with the Kwanzan stunting syndrome. However, it is highly homologous (97 to 100% identity) in two short genome regions with divergent LChV1 from North America, providing the first complete sequence for such divergent isolates. Although not providing a definite proof, the failure to detect any other viral agent in the V2356 SSD source and the identification of LChV1 in a second, independent, source of the disease suggests that LChV1 isolates could be responsible for the SSD syndrome.

Characterization by Deep Sequencing of Divergent Plum bark necrosis stem pitting-associated virus (PBNSPaV) Isolates and Development of a Broad-Spectrum PBNSPaV Detection Assay

Plum bark necrosis stem pitting-associated virus (PBNSPaV), the causal agent of plum bark necrosis stem pitting disease, belongs to the genus Ampelovirus in the family Closteroviridae. The complete genome sequence of PBNSPaV isolates from four Prunus sources was determined by pyrosequencing. All isolates showed the same genomic organization as the PBNSPaV reference isolate. The least divergent isolate, found in a peach tree from China, showed an overall 91.8% of nucleotide identity with the type isolate. Two closely related isolates, defining a second cluster of diversity, were found in two Japanese plum lines from France and showed only 82.8% identity with the type isolate. On the other hand, they were highly homologous with two recently described PBNSPaV divergent isolates from China. The fourth and most divergent isolate, from a Chinese peach, showed only 71.2% identity to other PBNSPaV isolates and was not detected by currently available PBNSPaV reverse-transcription polymerase chain reaction detection assays. Complete sequencing of the divergent isolates allowed the development of a more broad-spectrum detection test targeting a conserved region in the P61 gene. Taken together, these results indicate a much broader diversity of PBNSPaV than previously thought and provide for a more robust detection of this still poorly characterized pathogen.

Multiple Coat Protein Mutations Abolish Recognition of Pepino mosaic potexvirus (PepMV) by the Potato Rx Resistance Gene in Transgenic Tomatoes

Despite the fact that Pepino mosaic virus (PepMV) and Potato virus X (PVX) share less than 40% identity in their coat proteins (CP), the known PVX elicitor of Rx, transgenic tomato (cv. Microtom) plants expressing a functional potato Rx resistance gene showed resistance toward PepMV. However, in a low percentage of plants, PepMV accumulation was observed and back inoculation experiments demonstrated that these plants contained resistance-breaking PepMV variants. Sequencing of the CP gene of these variants showed the accumulation of mutations in the amino acid 41 to 125 region the CP, whereas no mutations were observed in the nonevolved isolates. Agroinfiltration-mediated transient expression of the mutant CP demonstrated that they had a greatly attenuated or abolished ability to induce a hypersensitive reaction in Rx-expressing Nicotiana benthamiana leaves. The transient expression of truncated forms of the PepMV CP allowed the identification of a minimal elicitor domain (amino acids 30 to 136). These results demonstrate that the Rx-based sensing system is able to recognize the PepMV CP but, contrary to the situation with PVX, for which only two closely spaced resistance-breaking mutations are known, many mutations over a significant stretch of the PepMV CP allow escape from recognition by Rx.

Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study

BackgroundApproaches to simplify and streamline the construction of full-length infectious cDNA clones (FL-cDNAs) are needed. Among desirable improvements are the ability to use total nucleic acids (TNA) extracts from infected hosts (to bypass viral purification limitations) for the direct one-step amplification of large FL-cDNAs, the possibility to inoculate plants with uncloned FL-cDNAs and the simplified cloning of these large molecules.ResultsUsing the 7.55 kb genome of Apple chlorotic leaf spot trichovirus (ACLSV) approaches allowing the rapid generation from TNA extracts of FL-cDNAs under the control of the T7 promoter and the successful inoculation of plants using in vitro transcripts obtained from these uncloned amplification products have been developed. We also show that the yeast homologous recombination system permits efficient cloning of FL-cDNAs and the simultaneous one-step tailoring of a ternary Yeast-Escherichia coli-Agrobacterium tumefaciens shuttle vector allowing efficient inoculation of both herbaceous and woody host plants by agroinfiltration.ConclusionsThe fast and efficient strategies described here should have broad applications, in particular for the study of difficult plant viruses, such as those infecting woody hosts, and potentially for other, non plant-infecting viral agents.

Characterization by Deep Sequencing of Prunus virus T, a Novel Tepovirus Infecting Prunus Species

Double-stranded RNAs purified from a cherry tree collected in Italy and a plum tree collected in Azerbaijan were submitted to deep sequencing. Contigs showing weak but significant identity with various members of the family Betaflexiviridae were reconstructed. Sequence comparisons led to the conclusion that the viral isolates identified in the analyzed Prunus plants belong to the same viral species. Their genome organization is similar to that of some members of the family Betaflexiviridae, with three overlapping open reading frames (RNA polymerase, movement protein, and capsid protein). Phylogenetic analyses of the deduced encoded proteins showed a clustering with the sole member of the genus Tepovirus, Potato virus T (PVT). Given these results, the name Prunus virus T (PrVT) is proposed for the new virus. It should be considered as a new member of the genus Tepovirus, even if the level of nucleotide identity with PVT is borderline with the genus demarcation criteria for the family Betaflexiviridae. A reverse-transcription polymerase chain reaction detection assay was developed and allowed the identification of two other PrVT isolates and an estimate of 1% prevalence in the large Prunus collection screened. Due to the mixed infection status of all hosts identified to date, it was not possible to correlate the presence of PrVT with specific symptoms.

Characterization of New Isolates of Apricot vein clearing-associated virus and of a New Prunus-Infecting Virus: Evidence for Recombination as a Driving Force in Betaflexiviridae Evolution

Double stranded RNAs from Prunus samples gathered from various surveys were analyzed by a deep-sequencing approach. Contig annotations revealed the presence of a potential new viral species in an Azerbaijani almond tree (Prunus amygdalus) and its genome sequence was completed. Its genomic organization is similar to that of the recently described Apricot vein clearing associated virus (AVCaV) for which two new isolates were also characterized, in a similar fashion, from two Japanese plums (Prunus salicina) from a French germplasm collection. The amino acid identity values between the four proteins encoded by the genome of the new virus have identity levels with those of AVCaV which fall clearly outside the species demarcation criteria. The new virus should therefore be considered as a new species for which the name of Caucasus prunus virus (CPrV) has been proposed. Phylogenetic relationships and nucleotide comparisons suggested that together with AVCaV, CPrV could define a new genus (proposed name: Prunevirus) in the family Betaflexiviridae. A molecular test targeting both members of the new genus was developed, allowing the detection of additional AVCaV isolates, and therefore extending the known geographical distribution and the host range of AVCaV. Moreover, the phylogenetic trees reconstructed with the amino acid sequences of replicase, movement and coat proteins of representative Betaflexiviridae members suggest that Citrus leaf blotch virus (CLBV, type member of the genus Citrivirus) may have evolved from a recombination event involving a Prunevirus, further highlighting the importance of recombination as a driving force in Betaflexiviridae evolution. The sequences reported in the present manuscript have been deposited in the GenBank database under accession numbers KM507061-KM504070.

First Report of Chrysanthemum stunt viroid in Various Cultivars of Argyranthemum frutescens in France

Described for the first time in Chrysanthemum indicum in the United States, Chrysanthemum stunt viroid (CSVd) was reported to naturally infect species in the Asteraceae family (1,3), as well a few hosts in other families. In May 2010 in a nursery in southwest France, the occurrence of stunted A. frutescens plantlets of cv. Butterfly showing yellow deformed leaves with terminal necrosis, which resembled the growth reduction, flower distortion or leaf necrosis symptoms reported for CSVd in Argyranthemum spp. (3), was reported. Mother plants from which the plantlets originated were asymptomatic. Reverse transcription (RT)-PCR with universal pospiviroid primers Pospi1-FW/RE (4) was performed on five symptomatic plants. A fragment of expected size (197 bp) was obtained in all cases. Viroid infection was confirmed by RT-PCR with two sets of primers: Vid-FW/RE using a 59°C annealing temperature instead of the recommended 62°C (4) and Vir-plus/minus that allows the amplification of the full-length viroid genome (2). Sequences of the three different uncloned amplicons were determined and a 355-nt contig was assembled (GenBank No. JF938538). A BLAST analysis of this full-length sequence revealed 99% identity with CSVd isolates from Chrysanthemum from Korea and Germany (GenBank Accession Nos. AF394452 and X16408). The Argyranthemum CSVd sequence differed from the Chrysanthemum ones by an A insertion at position 289 and substitutions (A to T) at positions 65 and 299. The insertion at position 289 is currently unique among CSVd sequences in GenBank. Thirty-five symptomless mother plants of A. frutescens cv. Butterfly were tested by PCR and all were shown to be infected. The difference in symptomatology observed between the mother plants and the commercial potting plants cannot be explained at this stage, but may reflect the different physiologies or growing conditions of the two kinds of plants, since these are known to affect CSVd symptoms in other hosts (1). To estimate the extent of CSVd contamination in A. frutescens, samples of 11 other cultivars originating from different nurseries were similarly analyzed. In addition to Butterfly, cvs. Sonnenstral, Maya Bofinger, Lili, Blanc Double, and Daisy Solenio were found to be infected by CSVd in the absence of clear symptomatology. The CSVd-free cultivars were Angelic Bordeaux, Dark Pink, Pink Delight, Angelic White, Dana, and Summer. The Pospi1-FW/RE amplicons from Blanc Double, Lili, and Daisy Solenio were identical to the Butterfly isolate sequence while the Maya Bofinger sequence showed one substitution (C to T) at position 256 and Sonnenstral had one substitution (T to A) at position 254. Although CSVd infection of Butterfly had been reported from Germany (3), to our knowledge, the results reported here represent the first report of CSVd in Argyranthemum for France and implicate a range of cultivars. CSVd being classified as a quarantine pest in Chrysanthemum spp. in the European Union, the finding of its significant prevalence in A. frutescens cultivars, frequently in the absence of clear symptomatology, raises the possibility that contaminated Argyranthemum may constitute a reservoir for future Chrysanthemum contamination. References: (1) I. Bouwnen and A. van Zaayen. Page 281 in: Viroids. Science Publishers, Enfield, NH, 2003. (2) T. Candresse et al. Plant Dis. 91:330, 2007. (3) W. Mentzel and E. Maiss. Z. Pflanzenk. Pfanzenschutz 107:548, 2000. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

Characterization of Prunus-infecting apricot latent virus-like Foveaviruses: evolutionary and taxonomic implications.

The complete genomic sequences of four Prunus-infecting Apricot latent virus (ApLV) like isolates were determined and used to analyze the taxonomic position and variability of these viruses. The results indicate that all isolates show a typical Foveavirus genetic organization. Despite an average 23% nucleotide divergence, they show strong colinearity with only three regions of significant indel variability, in the internal and 3 non-coding regions and variable N-terminal half of the coat protein (CP). Sequence comparisons using the polymerase (Pol) and CP genes provide a conflicting taxonomic picture, with divergence level in the Pol and CP genes suggesting the existence of a single or of two species, respectively. However, a range of considerations argue that all four isolates should likely be considered as belonging to the ApLV species. ApLV is closely related to Apple stem pitting virus and could be considered a sister species to it, with ASPV being specialized to infect members of the Maloideae family and ApLV members of the Prunoideae. Analysis of selection pressures affecting the five open reading frames of ApLV and ASPV identified two regions under strong purifying selection, that coding for the conserved C-terminal half of the CP and the gene coding for the first protein of the triple gene block (TGBp1).

New Insights into Asian Prunus Viruses in the Light of NGS-Based Full Genome Sequencing.

Double stranded RNAs were purified from five Prunus sources of Asian origin and submitted to 454 pyrosequencing after a random, whole genome amplification. Four complete genomes of Asian prunus virus 1 (APV1), APV2 and APV3 were reconstructed from the sequencing reads, as well as four additional, near-complete genome sequences. Phylogenetic analyses confirmed the close relationships of these three viruses and the taxonomical position previously proposed for APV1, the only APV so far completely sequenced. The genetic distances in the respective polymerase and coat protein genes as well as their gene products suggest that APV2 should be considered as a distinct viral species in the genus Foveavirus, even if the amino acid identity levels in the polymerase are very close to the species demarcation criteria for the family Betaflexiviridae. However, the situation is more complex for APV1 and APV3, for which opposite conclusions are obtained depending on the gene (polymerase or coat protein) analyzed. Phylogenetic and recombination analyses suggest that recombination events may have been involved in the evolution of APV. Moreover, genome comparisons show that the unusually long 3’ non-coding region (3 NCR) is highly variable and a hot spot for indel polymorphisms. In particular, two APV3 variants differing only in their 3’ NCR were identified in a single Prunus source, with 3 NCRs of 214–312 nt, a size similar to that observed in other foveaviruses, but 567–850 nt smaller than in other APV3 isolates. Overall, this study provides critical genome information of these viruses, frequently associated with Prunus materials, even though their precise role as pathogens remains to be elucidated.

First report of Southern tomato virus on tomatoes in southwest France.

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5 CTGGAGATGAAGTGCTCGAAGA 3 and STV-rev 5 TGGCTCGTCTCGCATCCTTCG 3) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.