Charles A. Rivers

Consistent associations of HLA class I and II and transporter gene products with progression of human immunodeficiency virus type 1 infection in homosexual men

Polymorphic products of genes in the HLA region contributing to variability in the course of human immunodeficiency virus type 1 (HIV-1) infection were identified by screening 375 Caucasian seroconverters who were aggregated from 3 cohorts. AIDS-free time was related to numerous (15) class I alleles, alone or in conjunction with transporter protein variants, to homozygosity at the A or B locus, and to alleles of two class II haplotypes. A prognostic scoring algorithm derived from the 3 cohorts captured multiple HLA contributions to protection or to risk (relative hazard=0.57-60 per unit increase in score, all P<<.001). The impact of HLA was strong and appeared independent of the effects of chemokine receptor/ligand polymorphisms and antiretroviral treatment. The algorithm also predicted divergent rates of CD4+ cell decline in 2 other groups, totaling 227 seropositive persons (P=.06 - <.001). Confirmation of these relationships should encourage investigation of HIV-1 antigen processing and presentation mediated by polymorphisms in the HLA region.

Genotypic and phenotypic heterogeneity of African Americans with primary iron overload

Primary iron overload may be relatively common in African Americans, but its cause is incompletely understood. Thus, we evaluated genotype and phenotype characteristics of unselected African American index patients with primary iron overload who reside in central Alabama. All had hepatic iron concentration > or =30 micromol/g dry wt or > or =2.0 g of iron mobilized by phlebotomy to achieve iron depletion. Genotype analyses were performed in African American control subjects from the same region. There were 23 patients (19 men, 4 women); mean age at diagnosis was 52 +/- 12 years (1 SD) (range 32-69 years). Nine (39.1%) reported that they consumed > or =45 g of ethanol daily; five had chronic hepatitis C. Eight had some form of hemoglobinopathy or thalassemia. Mean serum transferrin saturation was 56 +/- 28% (range 15-100%). The geometric mean serum ferritin at diagnosis was 1076 ng/mL [95% confidence interval 297-3473 ng/mL]. Increased stainable liver iron was observed in hepatocytes only in 4 patients, in macrophages only in 8 patients, and in hepatocytes and macrophages in 8 patients. The mean quantity of iron mobilized by phlebotomy (corrected for iron absorbed during treatment) was 5.3 +/- 2.0 g (range 4.0-8.4 g). Iron removed by phlebotomy was greater in patients with hemoglobinopathy or thalassemia than in those without these forms of anemia (6.6 +/- 1.3 g vs 3.9 +/- 1.6 g, respectively; P = 0.0144). Daily consumption of > or =45 g of ethanol or chronic hepatitis C was not associated with an increased or decreased amount of phlebotomy-mobilized iron, on the average. The percentage of index patients positive for HFE C282Y was greater than that of controls (P = 0.0058). The respective percentages of phenotype positivity for HFE H63D, D6S105(8), and HLA-A*03 were similar in patients and controls. HFE S65C, I105T, and G93R were not detected in index or control subjects. Two of 13 patients were heterozygous for the ferroportin allele nt 744 G-->T (Q248H), although the phenotype frequency of this allele was similar in patients and 39 controls. Synonymous ferroportin alleles were also detected in some patients. The ceruloplasmin mutation nt 1099C-->T (exon 6; Arg367Cys) was detected in 1 of 2 patients tested. Abnormal alleles of beta-2 microglobulin, Nramp2, TFR2, hepcidin, or IRP2 alleles were not detected in either of the 2 patients so tested. We conclude that primary iron overload in African Americans is not the result of the mutation of a single gene. HFE C282Y, ferroportin 744 G-->T, and common forms of heritable anemia appear to account for increased iron absorption or retention in some patients.

Development and Validation of a Semiquantitative, Multitarget PCR Assay for Diagnosis of Bacterial Vaginosis

ABSTRACT Quantitative PCR assays were developed for 4 organisms reported previously to be useful positive indicators for the diagnosis of bacterial vaginosis (BV)—Atopobium vaginae, Bacterial Vaginosis-Associated Bacterium 2 (BVAB-2), Gardnerella vaginalis, and Megasphaera-1—and a single organism (Lactobacillus crispatus) that has been implicated as a negative indicator for BV. Vaginal samples (n = 169), classified as positive (n = 108) or negative (n = 61) for BV based on a combination of the Nugent Gram stain score and Amsel clinical criteria, were analyzed for the presence and quantity of each of the marker organisms, and the results were used to construct a semiquantitative, multiplex PCR assay for BV based on detection of 3 positive indicator organisms (A. vaginae, BVAB-2, and Megasphaera-1) and classification of samples using a combinatorial scoring system. The prototype BV PCR assay was then used to analyze the 169-member developmental sample set and, in a prospective, blinded manner, an additional 227 BV-classified vaginal samples (110 BV-positive samples and 117 BV-negative samples). The BV PCR assay demonstrated a sensitivity of 96.7% (202/209), a specificity of 92.2% (153/166), a positive predictive value of 94.0%, and a negative predictive value of 95.6%, with 21 samples (5.3%) classified as indeterminate for BV. This assay provides a reproducible and objective means of evaluating critical components of the vaginal microflora in women with signs and symptoms of vaginitis and is comparable in diagnostic accuracy to the conventional gold standard for diagnosis of BV.

Influence of CYP2C9 Genotype on warfarin dose among African American and European Americans

BACKGROUND: Cytochrome P4502C9 (CYP2C9) plays a vital role in drug metabolism. There has been an increased effort to identify polymorphisms within the gene and determine their clinical consequences. However, most of these efforts have focused on populations of European descent. Herein we report the influence of CYP2C9 genotype on warfarin dose among European American and African American patients. We also identify two new mutations; one in the coding region and one in the non-coding region of the CYP2C9 gene. METHODS: Patients (≥20 years of age) are enrolled after obtaining medical, lifestyle and concomitant medication history. Changes in International Normalized Ratio (INR), warfarin dose, co-medications, diet, physical activity and the occurrence of complications are documented. CYP2C9 genotype was determined using PCR-RFLP and pyrosequencing. Differences in genotype frequencies and HWE assumptions were assessed using χ(2) statistics and exact tests. The genotype dose association was evaluated using multivariable linear regression. RESULTS: This report includes 490 patients (mean age 60.6 ± 15.6, 51.3% men). African American patients comprise 48.9% of the cohort with mean follow-up of 13.5 (±10.6) months. Both the CYP2C9 *2 and *3 allele were more frequent in European Americans (11.24%, 5.1%) compared to African Americans (1.1% and 1.8%). CYP2C9 *5 (0.9%), *6 (0.4%), and *11 (1.1%) variants were only observed in African Americans. The variant genotype is more frequent among European Americans compared to African Americans (29.8% vs. 9.73%, p<0.0001). Warfarin dose was significantly related to CYP2C9 genotype (p<0.0001) both in univariate and multivariate analyses. Multivariable race-specific analyses highlight the contribution of CYP2C9 genotype among European American but not among African American patients. CONCLUSION: The variant CYP2C9 genotype is more frequent among European Americans compared to African Americans. Among African Americans the variant genotype frequency is higher than previously reported. CYP2C9 genotype predicts warfarin dose in European Americans, but not in African Americans.

Detection of Trichomonas vaginalis DNA by Use of Self-Obtained Vaginal Swabs with the BD ProbeTec Qx Assay on the BD Viper System

ABSTRACT Trichomonas vaginalis is the most prevalent nonviral sexually transmitted infection worldwide, and improved diagnostic methods are critical for controlling this pathogen. Diagnostic assays that can be used in conjunction with routine chlamydia/gonorrhea nucleic acid-based screening are likely to have the most impact on disease control. Here we describe the performance of the new BD T. vaginalis Qx (TVQ) amplified DNA assay, which can be performed on the automated BD Viper system. We focus on data from vaginal swab samples, since this is the specimen type routinely used for traditional trichomonas testing and the recommended specimen type for chlamydia/gonorrhea screening. Vaginal swabs were obtained from women attending sexually transmitted disease or family planning clinics at 7 sites. Patient-collected vaginal swabs were tested by the TVQ assay, and the Aptima T. vaginalis (ATV) assay was performed using clinician-collected vaginal swabs. Additional clinician-collected vaginal swabs were used for the wet mount and culture methods. Analyses included comparisons versus the patient infection status (PIS) defined by positive results with the wet mount method or culture, direct comparisons assessed with κ scores, and latent class analysis (LCA) as an unbiased estimator of test accuracy. Data from 838 women, 116 of whom were infected with T. vaginalis, were analyzed. The TVQ assay sensitivity and specificity estimates based on the PIS were 98.3% and 99.0%, respectively. The TVQ assay was similar to the ATV assay (κ = 0.938) in direct analysis. LCA estimated the TVQ sensitivity and specificity as 98.3 and 99.6%, respectively. The TVQ assay performed well using self-collected vaginal swabs, the optimal sample type, as recommended by the CDC for chlamydia/gonorrhea screening among women.

Comparison of Nucleic Acid Amplification Assays with BD Affirm VPIII for Diagnosis of Vaginitis in Symptomatic Women

ABSTRACT A commercially available, nonamplified, nucleic acid probe-based test system (BD Affirm VPIII) was compared with nucleic acid amplification (NAA)-based assays for determining the etiology of vaginitis in a cohort of 323 symptomatic women. First, a semiquantitative, multiplexed PCR assay (BV-PCR) and the Affirm VPIII Gardnerella vaginalis test were compared with a unified bacterial-vaginosis (BV) reference standard incorporating both Nugent Gram stain scores and Amsel clinical criteria. In the evaluable population of 305 patients, BV-PCR was 96.9% (191/197) sensitive and 92.6% specific (100/108) for BV, while Affirm VPIII was 90.1% sensitive (179/197) and 67.6% specific (73/108). Second, a multiplexed PCR assay detecting Candida albicans and Candida glabrata (CAN-PCR) was compared with the Affirm VPIII Candida test using a reference standard for vulvovaginal candidiasis (VVC) of yeast culture plus exclusion of alternate vaginitis etiologies. In the population evaluated (n = 102), CAN-PCR was 97.7% sensitive (42/43) and 93.2% specific (55/59) and Affirm VP III was 58.1% sensitive (25/43) and 100% specific (59/59) for VVC. Finally, the results of a commercial NAA test (GenProbe Aptima Trichomonas vaginalis assay; ATV) for T. vaginalis were compared with the Affirm VPIII Trichomonas vaginalis test. In the absence of an independent reference standard for trichomonal vaginitis (TV), a positive result in either assay was deemed to represent true infection. In the evaluable cohort of 388 patients, the sensitivity of ATV was 98.1% (53/54) versus 46.3% (25/54) for Affirm VPIII. The diagnostic accuracy of the combined NAA-based test construct was approximately 20 to 25% higher than that of the Affirm VPIII when modeled in populations with various prevalences of infectious vaginitis.

Prevalence of Gardnerella vaginalis in male sexual partners of women with and without bacterial vaginosis.

Bacterial vaginosis (BV) is the most common form of vaginitis worldwide and has been linked to multiple reproductive tract complications including preterm birth and increased risk of acquiring STD/HIV.1–3 The pathogenesis of BV is poorly understood and there is lack of consensus on a possible etiologic agent, if any. The majority of epidemiologic data, however, suggests that BV is an STD.4–7 Early on, in the recognition of this syndrome it was accepted that Gardnerella vaginalis was the causative organism; however, this fell out of favor when it was reported that G. vaginalis could be cultured from women who did not meet the Amsel criteria for BV.8 In retrospect, although these women did not meet the clinical criteria for the diagnosis of BV, they also may have not had normal vaginal flora. Although BV flora is characterized by a multitude of organisms, the presence of G. vaginalis in the vaginal flora of women with BV is universal. Studies of G. vaginalis in men have been limited and few studies of concordance among sexual partners have been published and none using polymerase chain reaction (PCR). We determined the presence or absence of this organism from genitourinary specimens of male sexual partners of women with and without normal vaginal flora using G. vaginalis-specific PCR. Women attending the Jefferson County Department of Health STD Clinic for screening or a new problem were invited to participate in the study. Women were classified as having BV if they met the clinical criteria of Amsel et al.9 or as negative for BV if they did not fulfill this criteria. Women were administered standardized questionnaires regarding sexual behavior and a vaginal smear was obtained for Gram stain using the method of Nugent et al.10 Women were asked to refer sexual partners with whom they had had sexual intercourse within the past 2 weeks to the study for enrollment in the study. Men were also administered a questionnaire and examined for signs of STD. First fraction urine (15–20 mL) was collected, centrifuged, and the pellet resuspended in 5 mL of urine. The pellet mixture was refrigerated on-site then stored at 20 °C before processing. Swabs were obtained from the coronal sulcus and the urethra, placed into a dry sterile screw-capped tube, refrigerated on-site then stored at 20 °C before processing. Total DNA was extracted from urine sediment, urethral, and coronal sulcus swab specimens by inorganic extraction (Wizard Genomic Purification Kit, Promega, Madison, WI).11 Amplification of a conserved sequence within the G. vaginalis 16 S rRNA gene was carried out using previously reported primers: GVV6-U2 5 GACCATGCACCACCTGTGAA 3 and GV-V2-R1 5 TCGTGGAGGGTTCGATTCTG 3 .12 Reactions were carried out in 20 L containing template DNA, 1 CoralLoad Buffer (Qiagen, Valencia, CA), 200 mol/L of each dNTP, 0.5 mol/L of each primer, and 0.025 U/ L of HotStarTaq Plus (Qiagen, Valencia, CA). Amplification conditions on an iCycler (BioRad Laboratories, Hercules, CA) were as follows: 95 °C 5 /(94 °C 30 ; 60 °C 30 ; 72 °C 30 ) 30/72 °C 5 /4°C pause. Two negative controls were run on each amplification batch: water as template for reagent check and Mobiluncus mulieris. The positive control was laboratory cultured G. vaginalis. Amplicons were electrophoresed on 2% agarose/1 tris acetic acid EDTA (TAE) gels prestained with ethidium bromide, followed by photodigital documentation. G. vaginalis positivity (a band of 1041 base pairs) was defined as a positive PCR from at least 1 sampling of the specimen set. For comparisons of categorical data, Fisher exact test, and the 2 test were used. The Wilcoxon rank sum test was used to compare groups about continuous variables because a number of variables were not normally distributed. A total of 68 men were enrolled into the study, 29 (43%) as partners of women with BV and 39 (57%) as partners of women without BV. For the present analysis we limited inclusion to only those 47 (69.1%) men who had available specimens from all 3 sampling sites (urine, urethral swab, coronal sulcus swab). Women with BV by Amsel criteria had a median baseline Nugent score of 8 versus 2 for the women without BV (P 0.001). The only significant difference other than the baseline Nugent scores of the female partners was race. There was a significantly higher proportion of black subjects who were partners of women with BV than those who were partners to women without BV (Table 1). There were no significant differences between the 47 men who had samples available and the larger cohort (data not shown). G. vaginalis was detected in 12 patients [25%, 95% confidence The authors thank Marquita W. Lewis, MS-PHLS for her technical work on this project. This work was supported by National Institutes of Health grants Concordance Rates of Mobiluncus spp. Among Sexual Partners 1R03 HD42112-01 and Therapy and Prevention of Bacterial Vaginosis, R01 AI048044. The authors have no conflicts of interest to declare. Correspondence: Jane R. Schwebke, MD, University of Alabama at Birmingham, ZRB 239 703 19 Street South, Birmingham, AL. E-mail: schwebke@uab.edu. Received for publication May 2, 2008, and accepted July 29, 2008. From the *Department of Medicine University of Alabama, Birmingham, Alabama; and the †Department of Biostatistics, University of Arkansas for Medical Sciences, Little Rock, Arkansas Sexually Transmitted Diseases, February 2009, Vol. 36, No. 2, p.92–94 DOI: 10.1097/OLQ.0b013e3181886727 Copyright

Allele frequencies of hemojuvelin gene ( HJV ) I222N and G320V missense mutations in white and African American subjects from the general Alabama population

BackgroundHomozygosity or compound heterozygosity for coding region mutations of the hemojuvelin gene (HJV) in whites is a cause of early age-of-onset iron overload (juvenile hemochromatosis), and of hemochromatosis phenotypes in some young or middle-aged adults. HJV coding region mutations have also been identified recently in African American primary iron overload and control subjects. Primary iron overload unexplained by typical hemochromatosis-associated HFE genotypes is common in white and black adults in Alabama, and HJV I222N and G320V were detected in a white Alabama juvenile hemochromatosis index patient. Thus, we estimated the frequency of the HJV missense mutations I222N and G320V in adult whites and African Americans from Alabama general population convenience samples.MethodsWe evaluated the genomic DNA of 241 Alabama white and 124 African American adults who reported no history of hemochromatosis or iron overload to detect HJV missense mutations I222N and G320V using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Analysis for HJV I222N was performed in 240 whites and 124 African Americans. Analysis for HJV G320V was performed in 241 whites and 118 African Americans.ResultsOne of 240 white control subjects was heterozygous for HJV I222N; she was also heterozygous for HFE C282Y, but had normal serum iron measures and bone marrow iron stores. HJV I222N was not detected in 124 African American subjects. HJV G320V was not detected in 241 white or 118 African American subjects.ConclusionsHJV I222N and G320V are probably uncommon causes or modifiers of primary iron overload in adult whites and African Americans in Alabama. Double heterozygosity for HJV I222N and HFE C282Y may not promote increased iron absorption.

Prevalence of Gardnerella vaginalis among women with lactobacillus-predominant vaginal flora

Objectives To determine the prevalence of Gardnerella vaginalis in women with normal vaginal flora. Methods Women without symptoms or signs of vaginal infection and five or fewer lifetime sexual partners were recruited for a longitudinal study of vaginal flora. Negative Amsel criteria and a Nugent score of 0–3 were required for enrolment. Vaginal specimens were self-collected daily for Gram stain and every 3 days for PCR for G vaginalis for 30 days. Women completed daily diaries recording sexual activity, symptoms and menses. Results Twenty women were recruited for the study with 19 completing all specimens and 1 lost to follow-up. During the 30-day study period, 13/19 (68.4%) of women had normal Nugent scores (0–3) whereas 6/19 (31.6%) of women had at least 2 days of Nugent scores in the intermediate range (p=0.09). Among the 19 women, 9 (47%) were negative for G vaginalis by PCR throughout the study period whereas 10 (53%) had at least one specimen that demonstrated the presence of G vaginalis by PCR. Of those women with intermediate flora on Gram stain during the course of the study 5/6 (83.3%) were positive for G vaginalis while 5/13 (38.5%) of those women with only normal Nugent scores were positive for G vaginalis. Thus, 61.5% of women with normal Nugent scores had no evidence of G vaginalis by serial PCR. Conclusions Gardnerella may not be part of the normal flora in women with optimal vaginal health.

Prevalence of bacterial vaginosis and vulvovaginal candidiasis mixed infection in a southeastern american STD clinic.

Bacterial vaginosis (BV) was diagnosed in 72.5% of female participants. Among women with BV, 33.1% were colonized with yeast. Vulvovaginal candidiasis was observed in 15.7% of participants irrespective of BV status. Overall, the prevalence of BV/vulvovaginal candidiasis mixed infections among young women was observed to be 4.4%.