Cherng-Lih Perng

Quantitative PCR Analysis of Mitochondrial DNA Content in Patients with Mitochondrial Disease

Abstract: Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real‐time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5′TTACCGGGCTCTGCCATCT3′‐TAMRA and VIC‐5′AGCAATAACAGGTCTGTGATG3′‐TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5‐20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age‐matched group, and about 10% of patients had muscle mtDNA levels 2‐ to 16‐fold higher than the mean of the age‐matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Variable clinical manifestation of homoplasmic G14459A mitochondrial DNA mutation.

Leber hereditary optic neuropathy (LHON)/pediatric onset dystonia is associated with a G to A transition at nucleotide position (np) 14459, within the mitochondrial DNA (mtDNA)‐encoded ND6 gene. This mutation has been reported in families presenting with LHON alone, LHON plus dystonia, or pediatric dystonia with typical age of onset less than 5 years. The mutation changes a moderately conserved alanine to a valine at amino acid residue 72, which is within the most evolutionarily conserved region of the ND6 protein. Pediatric onset disease is associated with basal ganglia dysfunction, spasticity, and encephalopathy. We report a family with G14459A mtDNA mutation and a broad spectrum of clinical manifestation. The proband was a 3‐year‐old girl with anarthria, dystonia, spasticity, and mild encephalopathy. MRI of the brain demonstrated bilateral, symmetric basal ganglia lucencies associated with cerebral and systemic lactic acidosis. Her maternal first cousin presented with a new onset limp and mild hemiparesis along with similar MRI findings with a much milder phenotype. Additional investigation of the family members with the mutation has revealed both asymptomatic and symptomatic individuals with variable clinical and laboratory features of mitochondrial disease. This study re‐emphasizes the heterogeneous clinical manifestation of homoplasmic G14459A mtDNA mutation even within the same family, and supports the hypothesis that nuclear genes may play a role in modifying the clinical expression of mitochondrial disease. Published 2003 Wiley‐Liss, Inc.

Experience of using convalescent plasma for severe acute respiratory syndrome among healthcare workers in a Taiwan hospital

Abstract Objectives: To describe the immunological responses and clinical outcome of coronavirus (SARS) infected healthcare workers (HCW) who had been administered with convalescent plasma as a treatment. Methods: Convalescent plasma (500 mL) was obtained from each of three SARS patients and transfused into the three infected HCW. Donors were blood type O and seronegative for hepatitis B and C, HIV, syphilis and human T-cell lymphotropic virus types I and II (HTLV-I and -II). Serum antibody (IgG) titre was >640. Apharesis was performed with a CS 3000 plus cell separator followed by the forming of the convalescent phase plasma. As part of the routine check with donated plasma, the convalescent plasma was confirmed free of residual SARS-CoV by RT–PCR. Serial serum samples obtained from the recipients of the convalescent plasma were collected to undertake real-time quantitative RT–PCR for SARS-CoV for direct measurement of viral concentration. Specific immunoglobulin IgM and IgG concentrations were titrated using an antigen microarray developed in-house. Results: Viral load dropped from 495 × 103, 76 × 103 or 650 × 103 copies/mL to zero or 1 copy/mL one day after transfusion. Anti-SARS-CoV IgM and IgG also increased in a time-dependent manner following transfusion. All three patients survived. One HCW became pregnant subsequently, delivering 13 months after discharge. Positive anti-SARS-CoV IgG was detected in the newborn. Passive transfer of anti-SARS-CoV antibody from the mother was considered as a possibility. Conclusions: All infected HCW whose condition had progressed severely and who had failed to respond to the available treatment, survived after transfusion with convalescent plasma.

Compensatory amplification of mtDNA in a patient with a novel deletion/duplication and high mutant load

The clinical manifestations of patients with mitochondrial DNA (mtDNA) deletions are quite variable. Kearns-Sayre syndrome (KSS; OMIM #530000), the most commonly recognised phenotype, is characterised by the diagnostic triad of progressive external ophthalmoplegia (PEO, OMIM #555000), onset before 20 years of age, pigmentary retinopathy, and one or more of the following: cerebellar ataxia, cardiac conduction defect, and/or elevated protein concentration of greater than 1 g/L in cerebrospinal fluid.1 Other phenotypes associated with mtDNA deletions include chronic progressive external ophthalmoplegia, Pearson marrow-pancreas syndrome, Addison disease, diabetes mellitus, cyclic vomiting, deafness, optic atrophy, and renal tubulopathy.1–8 KSS typically occurs in adult patients, and the deleted mutant mtDNA is usually not present in blood.4 On the other hand, the clinical presentation of mtDNA deletion syndromes in infants and young children is variable and does not necessarily feature the classic symptoms seen in KSS. In severe cases with multisystemic involvement, a high percentage of deleted mutant mtDNA is present in all tissues examined. We describe a 41 year old woman who presented with atypical KSS at the age of 30 years. A novel mtDNA deletion was detected in both muscle and blood specimens of this patient, despite the finding of respiratory chain enzymes in the normal range in muscle samples. A 41 year old female was diagnosed with chronic PEO (CPEO), ptosis, and pigmentary retinopathy at the age of 30 years. The patient was born to a 21 year old, G2P1 healthy mother after an uneventful pregnancy. She had a blood transfusion during the neonatal period for hyperbilirubinaemia, and had an otherwise unremarkable childhood. She also had transient, mild iron deficiency anaemia at approximately 9 years of age. She progressed through a normal puberty and had two normal pregnancies at 29 and 30 years of age. Following her first pregnancy, …

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element.

MNGIE with lack of skeletal muscle involvement and a novel TP splice site mutation

Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is an autosomal recessive multisystem disorder caused by thymidine phosphorylase (TP) deficiency, resulting in severe gastrointestinal dysmotility and skeletal muscle abnormalities. A patient is reported with a classical MNGIE clinical presentation but without skeletal muscle involvement at morphological, enzymatic, or mitochondrial DNA level, though gastrointestinal myopathy was present. MNGIE was diagnosed by markedly raised plasma thymidine and reduced thymidine phosphorylase activity. Molecular genetic analysis showed a homozygous novel splice site mutation in TP. On immunohistochemical studies there was marked TP expression in the CNS, in contrast to what has been observed in rodents. It is important to examine the most significantly affected tissue and to measure TP activity and plasma thymidine in order to arrive at an accurate diagnosis in this condition.

Detection and typing of vancomycin-resistance genes of enterococci from clinical and nosocomial surveillance specimens by multiplex PCR

Ninety-three clinical isolates of vancomycin-resistant enterococci (VRE) collected from nine hospitals in Taiwan were examined for the presence of vanA, vanB, vanC1, or vanC2/vanC3 genes by a multiplex PCR. Forty-seven of these VRE isolates were vanA positive, 1 contained both vanC1 and vanA, 40 harboured vanB, 2 were vanC1, and 3 were identified to be vanC2/vanC3. Twenty-four vanA isolates were sensitive to teicoplanin and thus did not have a typical VanA phenotype. Five isolates with the VanC phenotype harboured vanB. None of the 40 clinically isolated vancomycin-susceptible E. faecium or E. faecalis and the vancomycin-resistant Leuconostoc and Pediococcus isolates were positive for any of the van genes. While performing nosocomial surveillance, VRE were isolated from 47 of 467 rectal swabs by culture. Compared with the conventional culture method, the sensitivity and specificity of the multiplex PCR for detecting and identifying vancomycin-resistance genes in enterococci directly from culture-positive broth were 97.9% and 100%, respectively. The results suggest that genotypic characterization of vancomycin-resistance is necessary for all clinical VRE isolates and that the multiplex PCR assay can be an alternative method for this purpose.

High Prevalence of VanB2 Vancomycin-Resistant Enterococcus faecium in Taiwan

ABSTRACT Thirty-six VanB glycopeptide-resistant Enterococcus faecium isolates were collected from patients in five different hospitals in Taiwan. The vancomycin resistance genes were amplified by the long vanB PCR, which amplifies the 6,373-bpvanB gene cluster including thevanRB2, vanSB2, vanYB2, vanWB2, vanHB2, vanB2, andvanXB2 genes. The deduced amino acid sequences were found to be 95 to 98% homologous to those of thevanB1 gene cluster: VanRB1, 97%; VanSB1, 97%; VanYB1, 96%; VanHB1, 95%; VanB1, 96%; and VanXB1, 98%. Restriction enzyme analysis of the long vanB PCR products revealed that all 36 isolates had the same vanB2-specific pattern. DNA sequence analysis of the vanB2 gene, which is ad-Ala–d-Lac ligase gene, revealed that none of the 36 sequences were identical to the previously publishedvanB2 sequence. Thirty-one isolates had 1 nucleotide different from the published vanB2 sequence. The sequences of the other five isolates differed from the publishedvanB2 sequence by 2 or 3 nucleotides. Four isolates with a low or moderate resistance to vancomycin (MIC = 4 to 32 μg/ml) were found to have the same leucine-to-methionine change at amino acid position 308 of the vanB2 gene. The genomic DNAs of all 36 isolates were digested with SmaI and then typed by pulsed-field gel electrophoresis (PFGE). Eight different PFGE types (I to VIII) were observed, and type I was found to be prevalent in all hospitals examined in this study. This result suggests that intra- and interhospital dissemination of this E. faecium strain has occurred in Taiwan.

HPV‐associated cervical cancers show frequent allelic loss at 3p14 but no apparent aberration of FHIT mRNA

The genetic aberration involved in the loss of heterozygosity (LOH) at 3p14 has recently been attributed to the disruption of the FHIT gene in many cancers. This study analyzed HPV DNA and allelic status of 5 microsatellite markers spaning 3p13‐3p25 in 57 cases of cervical cancer. With no homozygous deletion found in any case, a 39% overall frequency of LOH was noted. The presence of tumorigenic HPV DNA (91%) did not correlate with the allelic loss at any marker, including THRB (3p22‐24) and D3S1228 (3p14) which were found with high LOH rates of 43% (12/28) and 37% (11/30), respectively. Further analysis of FHIT mRNA in 29 cancers by reverse transcription (RT)‐PCR showed a full‐length transcript in all cases. However, additional minor transcripts were occasionally observed in cancer tissues (9/29) as well as in normal tissues (12/31) by nested PCR of the RT products. Sequence analysis of these transcripts showed exclusive internal exon deletions, suggesting a source of minor splicing variants. No apparent mutation of the mRNA sequences was found in 8 transcripts examined, except for a silent polymorphism and a site of alternative splicing. The results suggest that, although frequently reported to be abrogated in several cancers, the mRNA of FHIT remains intact in cervical cancer. Other genes closely linked to FHIT may be responsible for frequent LOH at 3p14 observed in cervical cancer. Int. J. Cancer 75:199–204, 1998.

Detecting Mycobacterium tuberculosis in Bactec MGIT 960 Cultures by Inhouse IS6110-based PCR Assay in Routine Clinical Practice

BACKGROUND/PURPOSE Diagnosis of tuberculosis is challenging because the current methods are time-consuming and laborious. We have developed a method combining the Bactec MGIT 960 rapid culture system with the IS6110-based PCR for rapid diagnosis of tuberculosis. METHODS A total of 1745 samples from 712 patients treated at the Tri-Service General Hospital, Taipei, Taiwan between June and August 2005 were tested. An aliquot of positive Bactec MGIT 960 culture fluids was Kinyoun stained, and the samples positive for Kinyoun staining were directly assayed by the IS6110-based PCR. The same samples were also examined by the conventional methods for identification of Mycobacterium tuberculosis complex. RESULTS One hundred and four samples from 62 patients were positive according to the Bactec MGIT 960 system. Among these, 59 (56.7%) were positive and 45 (43.3%) were negative according to the IS6110-based PCR. Compared with the conventional identification methods, the IS6110-based PCR assay correctly identified all 59 M. tuberculosis isolates and gave negative results for all nontuberculosis mycobacteria. The mean turnaround time for M. tuberculosis identification by this combined method was 6.41 days for smear-positive and 14.33 days for smear-negative specimens. The sensitivity of the IS6110-based PCR assay was determined to be 5 cells or 0.1 pg of mycobacterial DNA. CONCLUSION The combined use of the automated Bactec MGIT 960 system and the IS6110-based PCR assay is sensitive and rapid for the detection of M. tuberculosis complex, and we recommend that this method be used routinely for identification of mycobacteria in clinical laboratories.