Chris J. Adams

RNA Bacteriophage Capsid-Mediated Drug Delivery and Epitope Presentation

Objective: To use our knowledge of the three-dimensional structure and self-assembly mechanism of RNA bacteriophage capsids to develop novel virus-like particles (VLPs) for drug delivery and epitope presentation. Methods: Site-directed mutagenesis of a recombinant MS2 coat protein expression construct has been used to generate translational fusions encompassing short epitope sequences. These chimeric proteins still self-assemble in vivo into T = 3 shells with the foreign epitope in an accessible location. Covalent conjugation has also been used to generate RNA stem-loops attached to the toxin, ricin A chain, or to nucleotide-based drugs, that are still capable of stimulating self-assembly of the capsid in vitro. These packaged drugs can then be directed to specific cells in culture by further covalent decoration of the capsids with targeting molecules. Results: Chimeric VLPs are strongly immunogenic when carrying either B or T cell epitopes, the latter generating cytokine profiles consistent with memory responses. Immune responses to the underlying phage epitopes appear to be proportional to the area of the phage surface accessible. Phage shells effectively protect nucleic acid-based drugs and, for the toxin construct, make cell-specific delivery systems with LD50 values in culture sub-nanomolar. Conclusion: VLP technology has potential for therapeutic and prophylactic intervention in disease.

Crystal structures of a series of RNA aptamers complexed to the same protein target.

We have determined the crystal structures, at 2.8 Å resolution, of two different RNA aptamers, each bound to MS2 coat protein. One of the aptamers contains a non-Watson-Crick base pair, while the other is missing one of the unpaired adenines that make sequence-specific contacts in the wild-type complex. Despite these differences, the RNA aptamers bind in the same location on the protein as the wild-type translational operator. Comparison of these new structures with other MS2-RNA complexes allows us to refine further the definition of the minimal recognition elements and suggests a possible application of the MS2 system for routine structure determination of small nucleic acid motifs.

Probing sequence-specific RNA recognition by the bacteriophage MS2 coat protein.

We present the results of in vitro binding studies aimed at defining the key recognition elements on the MS2 RNA translational operator (TR) essential for complex formation with coat protein. We have used chemically synthesized operators carrying modified functional groups at defined nucleotide positions, which are essential for recognition by the phage coat protein. These experiments have been complemented with modification-binding interference assays. The results confirm that the complexes which form between TR and RNA-free phage capsids, the X-ray structure of which has recently been reported at 3.0 A, are identical to those which form in solution between TR and a single coat protein dimer. There are also effects on operator affinity which cannot be explained simply by the alteration of direct RNA-protein contacts and may reflect changes in the conformational equilibrium of the unliganded operator. The results also provide support for the approach of using modified oligoribonucleotides to investigate the details of RNA-ligand interactions.

Determination of the Catalytic Parameters of the N-terminal Half of Escherichia coli Ribonuclease E and the Identification of Critical Functional Groups in RNA Substrates

Ribonuclease E is required for the rapid decay and correct processing of RNA in Escherichia coli. A detailed understanding of the hydrolysis of RNA by this and related enzymes will require the integration of structural and molecular data with quantitative measurements of RNA hydrolysis. Therefore, an assay for RNaseE that can be set up to have relatively high throughput while being sensitive and quantitative will be advantageous. Here we describe such an assay, which is based on the automated high pressure liquid chromatography analysis of fluorescently labeled RNA samples. We have used this assay to optimize reaction conditions, to determine for the first time the catalytic parameters for a polypeptide of RNaseE, and to investigate the RNaseE-catalyzed reaction through the modification of functional groups within an RNA substrate. We find that catalysis is dependent on both protonated and unprotonated functional groups and that the recognition of a guanosine sequence determinant that is upstream of the scissile bond appears to consist of interactions with the exocyclic 2-amino group, the 7N of the nucleobase and the imino proton or 6-keto group. Additionally, we find that a ribose-like sugar conformation is preferred in the 5′-nucleotide of the scissile phosphodiester bond and that a 2′-hydroxyl group proton is not essential. Steric bulk at the 2′ position in the 5′-nucleotide appears to be inhibitory to the reaction. Combined, these observations establish a foundation for the functional interpretation of a three-dimensional structure of the catalytic domain of RNaseE when solved.

Incorporation of a fluorescent nucleotide into oligoribonucleotides

The fluorescent nucleoside 2-pyrimidinone-1-β-d-riboside (4HC) has been incorporated into oligoribonucleotides using standard cyanoethyl phosphoramidite methods. This base provides a useful probe for the exocyclic amino function in cytidine. Cleavage of hammerhead ribozymes using GCGCCGAAACACCGUGUCUCGAGC as the substrate and GGCUCGA[4HC]UGAUGAGGCGC as a modified ribozyme resulted in a cleavage rate 17.5-fold slower than the unmodified analogue. The strand GGCUCGACUGA[4HC]GAGGCGC represents an oligoribonucleotide in which a fluorescent base is introduced into a site non-essential for ribozyme function but is centrally located in the ribozymes core of conserved nucleotides, thus providing a possible physical probe for ribozyme cleavage.

Excitation of leaky lamb waves in cranial bone using a phased array transducer in a concave therapeutic configuration

Ultrasonic therapeutic transducers that consist of large numbers of unfocused, low power elements have begun to replace single, focused, high power elements. This allows the operator to use phased array techniques to change the focal position in the tissue during therapy. In transcranial therapy, this phased array configuration is essential to reduce local heating at the highly attenuating bone. Recently, Dual Mode Ultrasound Arrays (DMUAs) have been developed which leverage existing elements for imaging during therapy. DMUAs have the benefit of both the therapeutic and imaging systems being co-registered. This improves upon the existing approach of using a separate ultrasound system for guidance, as the acoustic beam path is the same for both. Unfortunately, the highly reflective nature of bone means that DMUAs have not been applied to transcranial therapy. However the recent near-field observation of lamb waves in cranial bone opens the possibility for DMUAs to be applied to a guided wave scan of the sk...

Performance of switched mode arbitrary excitation using Harmonic Reduction Pulse Width Modulation (HRPWM) in array imaging applications

Switched excitation allows the miniaturisation of excitation circuitry for transducer integrated front ends, high channel count and portable ultrasound systems. Harmonic Reduction Pulse Width Modulation (HRPWM) provides a method to design five level switched mode excitation signals with control of instantaneous amplitude, frequency and phase plus minimised third harmonics for advanced ultrasound applications. This paper details the application of HRPWM using commercial transmit front end integrated circuits and linear array transducers. The ability of HRPWM to control the pressure of the ultrasound wave is investigated. A full scale error between desired and measured pressure of 3.5% at 4.1 MHz is demonstrated. The temporal windowing of linear frequency modulated excitation signals using HRPWM is demonstrated. Pulse compression linear imaging of a tissue phantom is demonstrated where an improvement in the -20 dB axial resolution of a nylon mono-filament target from 2.14 mm using bipolar excitation to 1.88 mm using HRPWM is shown.

Specimen-agnostic guided wave inspection using recursive feedback

Lamb waves, a configuration of guided waves are often applied to the inspection of plate like structures. Their complex, multi-modal nature makes them well suited to the inspection of different defects. Control over their propagation direction allows the engineer to increase inspection distance and prospectively locate the defect. Schemes already exist, but they require knowledge of material and its dispersion curves. If the material composition is not known, or external factors are effecting its speed of sound then these schemes may not be appropriate. The recursive feedback algorithm can be used to enhance guided waves in a single direction without a-priori knowledge. In recursive feedback, a guided wave is generated using the first element of an array transducer. Over several subsequent iterations, this guided wave is reinforced by re-transmitting recorded out of plane displacements. In this work, recursive feedback has been applied to two inspection problems; a contaminated kissing bond and a plate with a defect. With the kissing bond, it is shown that the the contamination can be identified as the A0 mode of generated waves are absorbed. In the defective plate, the defect direction is identified by a 10 dB increase in reflected energy when the guided waves are enhanced in one direction.

An Adaptive Array Excitation Scheme for the Unidirectional Enhancement of Guided Waves.

Control over the direction of wave propagation allows an engineer to spatially locate defects. When imaging with longitudinal waves, time delays can be applied to each element of a phased array transducer to steer a beam. Because of the highly dispersive nature of guided waves, this beamsteering approach is sub-optimal. More appropriate time delays can be chosen to direct a guided wave if the dispersion relation of the material is known. Existing techniques however need a priori knowledge of material thickness and acoustic velocity, which changes as a function of temperature and strain. The scheme presented here does not require prior knowledge of the dispersion relation or properties of the specimen to direct a guided wave. Initially, a guided wave is generated using a single element of an array transducer. The acquired waveforms from the remaining elements are then processed and re-transmitted; constructively interfering with the wave as it travels across the spatial influence of the transducer. The scheme intrinsically compensates for the dispersion of the waves and thus can adapt to changes in material thickness and acoustic velocity. The proposed technique is demonstrated in simulation and experimentally. Dispersion curves from either side of the array are acquired to demonstrate the schemes ability to direct a guided wave in an aluminium plate. Results show that uni-directional enhancement is possible without a priori knowledge of the specimen using an arbitrary pitch array transducer. Experimental results show a 34 dB enhancement in one direction compared with the other.Control over the direction of wave propagation allows an engineer to spatially locate defects. When imaging with longitudinal waves, time delays can be applied to each element of a phased array transducer to steer a beam. Because of the highly dispersive nature of guided waves (GWs), this beamsteering approach is suboptimal. More appropriate time delays can be chosen to direct a GW if the dispersion relation of the material is known. Existing techniques, however, need a priori knowledge of material thickness and acoustic velocity, which change as a function of temperature and strain. The scheme presented here does not require prior knowledge of the dispersion relation or properties of the specimen to direct a GW. Initially, a GW is generated using a single element of an array transducer. The acquired waveforms from the remaining elements are then processed and retransmitted, constructively interfering with the wave as it travels across the spatial influence of the transducer. The scheme intrinsically compensates for the dispersion of the waves, and thus can adapt to changes in material thickness and acoustic velocity. The proposed technique is demonstrated in simulation and experimentally. Dispersion curves from either side of the array are acquired to demonstrate the scheme’s ability to direct a GW in an aluminum plate. The results show that unidirectional enhancement is possible without a priori knowledge of the specimen using an arbitrary pitch array transducer. The experimental results show a 34-dB enhancement in one direction compared with the other.

A phase velocity filter for the measurement of lamb wave dispersion

The complex, multi-modal and dispersive nature of guided waves makes them extremely effective in the non destructive evaluation of plate-like structures. Knowledge of the dispersion relation of a material is a prerequisite to many guided wave experiments. A frequency-phase velocity map is by far the most useful representation of dispersion. These phase velocity curves can be obtained numerically by solving the Lamb equations, however instabilities and unfamiliarity with the specimens parameters makes experimentally obtained dispersion relation desirable. Transformations can be applied to an experimentally obtained frequency-wave number map but it requires prohibitively high number of sampling points in space to resolve modes across the full bandwidth of the transducer. The phase velocity filter described here is able to extract wavelets of a particular phase velocity irrespective of frequency. When applied to the acquisition of dispersion relation, the technique exhibits reduced artefacts and is able to extract modes across the full bandwidth of the excitation. Results show a bandwidth increase of approximately 58%.