Christien J. van der Woude

Impact of double-balloon enteroscopy findings on the management of Crohn's disease

Abstract Objective. It is estimated that 10%–30% of Crohns disease (CD) patients have small-bowel lesions, but the exact frequency and clinical relevance of these findings are unknown. Double-balloon enteroscopy (DBE) enables endoscopic visualization of the small bowel. The aim of this study was to evaluate the use of DBE for detecting small-bowel lesions in CD patients suspected of having small-bowel involvement. Furthermore, the clinical impact of adjusting treatment in these patients was assessed. Material and methods. A prospective study was performed in a tertiary referral center. CD patients suspected of small-bowel involvement and in whom distal activity had previously been excluded were included. All patients underwent DBE, followed by step-up therapy in patients with small-bowel lesions. The presence of small-bowel lesions during DBE was noted and clinical outcome was assessed after adjusting therapy. Results. Thirty-five patients (70%) showed small-bowel lesions; these lesions could not be assessed by conventional endoscopy in 23 (46%). At 1-year follow-up, step-up therapy in 26 patients (74%) led to clinical remission in 23 (88%). This was confirmed by a significant decrease in Crohns disease activity index and mucosal repair on second DBE. Conclusions. DBE showed a high frequency of small-bowel lesions in known CD patients with clinically suspected small-bowel activity. Most of these lesions were not accessible for conventional endoscopy. Adjusting treatment in patients with small-bowel CD involvement led to clinical remission and mucosal repair in the majority of cases.

Reproductive wish represents an important factor influencing therapeutic strategy in inflammatory bowel diseases.

Abstract Objective. Inflammatory bowel disease (IBD) affects patients in reproductive age but little is known about the peri-conceptional use of medication for IBD. The aim of this study was to assess the type of medication used by IBD patients with the desire to reproduce and changes in medication in the peri-conceptional period. Material and methods. IBD patients with active conception plans and pregnant patients were prospectively recruited from the outpatient clinic of a single academic medical center. IBD-related medication and changes in this medication for reasons of a desire to conceive or pregnancy were analyzed. Results. In total, 61 patients (51 females; 40 with Crohns disease, 21 with ulcerative colitis) were included. Thirteen patients (21%) used no medication, 44 (72%) used monotherapy and four (7%) used combination treatment. Of patients on monotherapy, 11 (19%) used 5-aminosalicylates, five (9%) used steroids, 11 (19%) used thiopurines, five (9%) used methotrexate and 11 (19%) used anti-tumor necrosis factor agents. Thirty-seven patients (61%) consulted a physician prior to conception. About one-third of these patients required a change in their medication due to their conception plans. Conclusions. In a referral center, the majority of IBD patients with conception plans require medication for which limited information on the safety of peri-conceptional use is available. In addition, the desire to reproduce leads to medication changes in about one-third of these patients.

Evolution of Endoscopic Activity Scores in Patients With Crohn's Disease Under Azathioprine and/or Infliximab: A Post-Hoc Analysis of the Sonic Data

Background: Genetic polymorphisms in the carnitine organic cation transporter (OCTN) and mutations in disc large homologue 5 (DLG5) have been associated with the development of Crohn Disease (CD). Preliminary functional studies have demonstrated that the OCTN1/ 2 variants resulted in impaired transporter function of various organic cations and carnitine, however, no previous studies have explored the expression of these genes in the mucosa from patients with ulcerative colitis (UC). Aim: To study the DLG5, OCTN1 and OCTN2 gene expression in colonic mucosa from patients with UC. Material and Methods: We studied the DLG5 gene expression from colonic biopsies of UC patients from August 2009 to July 2010. All individuals were divided in 3 groups: 1) Active UC (n=25); 2) Quiescent UC (n= 20); and 3) Healthy Control group (n=24). Expression of mRNA DLG5, OCTN1 and OCTN2 were measured by Real Time Polymerase Chain Reaction (RT-PCR) method. The following primers were used: DLG5: left tccagtagtgattcctgctcagt; and right: gagctccggggagagttc; OCTN1: left cggaatattgccataatgacc and right cagagcaaagtaacccactgag; OCTN2: left: gcagtgtccttctcttcatgc and right: gaaaaggcagccgtgactc; GADPH left agccacatcgctcagacac and right gcccaatacgaccaaatcc for normalization. The data analysis was performed by Kruskall-Wallis and Spearman tests using the SSPS Program Version 15.0 for Windows. Results: These results showed that DLG5 mRNA expression was increased from colonic mucosa in patients with active UC as compared to healthy control group (p<0.0001) as well as UC in remission was up-regulated when compared to healthy control group (p<0.0001). No significant differences were found between active and remission UC groups in the DLG5 gene expression. On the other hand, the OCTN1 and OCTN2 gene expression were significantly decreased in active and remission UC patients as compared to healthy normal controls (p=0.001 y p=0.005 respectively). No significant differences were found between active and remission UC groups in the OCTN1 andOCTN2 gene expression. Conclusions: The gene expression of DLG5was found increased in UC patients suggesting that over-expression of DLG5 gene could act as defence mechanism in UC patients with altered intestinal permeability. On the other hand, a decreased gene expression of OCTN1 and OCTN2 genes in UC patients might suggest that both genes are involved in the impaired intestinal permeability.

1160 Adding Ciprofloxacin to Adalimumab Results in a Higher Fistula Closure Rate in Perianal Fistulizing Crohn's Disease

Background: There is clear benefit of combination therapy for infliximab (IFX) with immunosuppressive drugs (IS), whether commenced together, or later, but no data are available for ADA. The aim was to assess whether IS combotherapy (CoT) was more effective than monotherapy for Crohn’s disease (CD) patients treated with ADA, using the semester approach. Methods: Retrospective study of patients with CD (n = 181) treated for at least one year with ADA in Oxford, UK or Liege, Belgium. Treatment periods were divided into 6 month semesters and the treatment failure compared between semesters with or without CoT (thiopurines or methotrexate). ADA failure was defined as dose modification during therapy, drug modification, perineal complications, or surgery for active CD. Results: 569 semesters were studied in 181 patients (Oxford n = 98, Liege 83), including 147 semesters in 45 patients having received CoT during the first semester. More patients in Oxford received CoT than Liege (OR: 4.82, p < 0.0001) and fewer females (OR 0.50, p = 0.01). When considering only patients on CoT during the first semester, treatment failures were less frequent in semesters with IS (20%) compared to semesters without IS (80%; OR 0.30, p = 0.02). This protective effect of the CoT was maintained over time (p = 0.01). When considering all the patients, CoT in the first semester was associated with a lower frequency of treatment failures (34% vs 66%, OR 0.69, p = 0.046) in univariate analysis but not in multivariate analysis. CoT later after induction of ADA was not associated with treatment failures. Female gender (OR 1.68, p = 0.01), previous surgery (OR 1.89, p = 0.001) and active perianal disease (OR 1.57, p = 0.02) were risk factors of failure on multivariate analysis. Although failures were less common in Oxford (OR 0.52, p = 0.001), more failures in Oxford had surgery (OR 8.85, p = 0.001) or perianal complications (OR 3.33, p = 0.01) and fewer had ADA weekly (OR 0.24, p = 0.0003) on multivariate analysis. The overall number of operations and perianal complications did not differ between CoT and ADA monotherapy. Thiopurines appeared more effective than methotrexate for preventing failure (OR 0.35, p = 0.03). The probablility of failure did not increase over the semesters (p = 0.86). Conclusions: When it was given during the first semester, CoT with ADA in CD was associated with fewer semesters with treatment failures (essentially the need for dose escalation or treatment modification, but not the rate of surgery or perianal complications). OP16 Adding ciprofloxacin to adalimumab results in a higher fistula closure rate in perianal fistulizing Crohn’s disease P. Dewint1 *, B. Hansen1, E. Verhey1, B. Oldenburg2, D.W. Hommes3, M. Pierik4, C. Ponsioen5, H. van Dullemen6, M.G. Russel7, A. van Bodegraven8, C.J. van der Woude1, on behalf of ICC (Initative on Crohn’s and Colitis). 1Erasmus Medical Center, Department of Gastroenterology & Hepatology, Rotterdam, Netherlands, 2University Medical Centre Utrecht, Department of Gastroenterology, Utrecht, Netherlands, 3UCLA, Division of Digestive Diseases, Los Angeles, United States, 4Maastricht University Medical Center, Dept of Gastroenterology, Maastricht, Netherlands, 5Academic Medical Center, Gastroenterology and Hepatology, Amsterdam, Netherlands, 6UMC Groningen, Gastroenterology, Groningen, Netherlands, 7Medisch Spectrum Twente, Gastroenterology, Enschede, Netherlands, 8VU University Medical Center, Gastroenterology, Amsterdam, Netherlands

SOCS3 Expression is a Predictive Factor of Relapse of Mucosal Inflammation in Chronic UC

Background and aims: Ulcerative colitis (UC) is chronic relapsing-remitting disease. Whereas it has been well characterized how various drug induce remission, the mechanisms involved in relapse are not known. We have previously shown that the epithelial expression of SOCS3, a negative regulator of cytokine signaling, was persistently upregulated in both active and inactive UC. Since the expression of SOCS3 during inactive disease may make the epithelial cells more vulnerable to various insults, we investigated whether this expression during remission was associated with the time till relapse. Materials and methods: 41 chronic UC patients in clinical remission underwent a first surveillance colonoscopy between 20012004, and were followed up till 2010. Biopsies from the first surveillance colonoscopy after remission were stained for SOCS3 protein expression and scored according to percentage of positive epithelial cells. Only biopsies from patients with clinical remission and without signs of histological inflammation were included. Clinical data, endoscopy and histology reviews were collected from patient charts. Results: 23 Patients (57.0%) of the 41 chronic UC patients developed histological relapse, and 19 patients (46.3%) had endoscopic relapse of colitis during the course of surveillance. SOCS3 protein expression in colon biopsies of inactive UC patients had a negative correlation with the time till histological (p<0.001) and endoscopic (p=0.007) relapse. Patients with higher epithelial SOCS3 expression at early remission suffered from a significantly more severe colitis during relapse (p=0.001). There was no correlation with CRP levels. Conclusion: Here we found that high levels SOCS3 expression in epithelial cells during remission was associated with a shorter time till relapse and increased severity of inflammation during relapse. These data further strengthen our hypothesis that SOCS3 expression may contribute to enhanced vulnerability of the intestinal epithelial cells during remission. As such, the dynamic changes and the mechanisms involved in this SOCS3 expression during mucosal remission will be further investigated.

European experience with methotrexate treatment in Crohn's disease: a multicenter retrospective analysis.

Introduction Methotrexate (MTX) has been utilized for the treatment of Crohn’s disease (CD) for decades. Nevertheless, current data provide equivocal evidence on the efficacy of MTX in CD. The aims of this study were to describe the efficacy of MTX for maintenance of remission in CD and to identify the factors associated with the probability of steroid-free clinical remission in a multicenter European referral center cohort. Patients and methods This was a retrospective cohort analysis. Consecutive patients treated with MTX for CD were included from 11 referral centers. Patients receiving concomitant treatment with tumor necrosis factor inhibitors or thiopurines were excluded. The main outcome was steroid-free clinical remission; the secondary outcomes included the rate of complications leading to MTX discontinuation and duration of relapse-free survival in patients achieving the main outcome. Results Between July 1992 and January 2012, 118 patients were identified for inclusion. MTX administration route was oral for induction in 31.4% and for maintenance in 49.1% of the patients. Steroid-free remission was achieved in 44/118 (37.2%) patients and was maintained relapse free by 28/44 (63.6%) for a median of 12 (3.5–18.5) months. At least one adverse effect was reported by 28.9% of the patients. No clinical or demographic factors were associated with either likelihood of achieving a clinical response or duration of relapse-free survival. Conclusion MTX treatment induced steroid-free clinical remission in over a third of CD patients and maintained it for a year in almost two-thirds of the responders. MTX should be considered a viable therapeutic option in CD patients refractory to other therapies.

Sa1987 Lipid Phosphatase SHIP2 Functions As Oncogene in Colorectal Cancer by Regulating PKB Activation

Colorectal cancer (CRC) is the second most common cause of cancer-related death, encouraging the search for novel therapeutic targets affecting tumor cell proliferation and migration. These cellular processes are under tight control of two opposing groups of enzymes; kinases and phosphatases. Aberrant activity of kinases is observed in many forms of cancer and as phosphatases counteract such “oncogenic” kinases, it is generally assumed that phosphatases function as tumor suppressors. However, emerging evidence suggests that the lipid phosphatase SH2-domain-containing 5 inositol phosphatase (SHIP2), encoded by the INPPL1 gene, may act as an oncogene. Just like the well-known tumor suppressor gene Phosphatase and Tensin Homolog (PTEN) it hydrolyses phosphatidylinositol (3,4,5) triphosphate (PI(3,4,5)P3). However, unlike PTEN, the reaction product is PI(3,4)P2, which is required for full activation of the downstream protein kinase B (PKB/Akt), suggesting that SHIP2, in contrast to PTEN, could have a tumor initiating role through PKB activation. In this work, we investigated the role of SHIP2 in colorectal cancer. We found that SHIP2 and INPPL1 expression is increased in colorectal cancer tissue in comparison to adjacent normal tissue, and this is correlated with decreased patient survival. Moreover, SHIP2 is more active in colorectal cancer tissue, suggesting that SHIP2 can induce oncogenesis in colonic epithelial cells. Furthermore, in vitro experiments performed on colorectal cancer cell lines shows an oncogenic role for SHIP2, by enhancing chemoresistance, cell migration, and cell invasion. Together, these data indicate that SHIP2 expression contributes to the malignant potential of colorectal cancer, providing a possible target in the fight against this devastating disease.

30 Fatigue in IBD Patients is Associated With Differences in Immune Parameters

P189 Fatigue in IBD patients is associated with differences in immune parameters C. de Haar1 *, L. Vogelaar1, B. Aerts1, M.P. Peppelenbosch2, E. Kuipers3, C.J. van der Woude4. 1Erasmus Medical Center, Gastroenterology and Hepatology, Rotterdam, Netherlands, 2Erasmus Medical Center, Department of Gastroenterology and Hepatology, Rotterdam, Netherlands, 3Erasmus Medical Center, Rotterdam, Netherlands, 4Erasmus Medical Center, Department of Gastroenterology & Hepatology, Rotterdam, Netherlands

Su1328 Fertility in IBD Women Is Comparable to Fertility in Non-IBD Controls

G A A b st ra ct s theme of personal ownership of specimens (OR 0.27 (95% CI 0.17-0.43) was significantly associated with allowing ongoing sample use after closure. Conclusions: While willingness to participate in the proposed biobank was high, most respondents wanted to know upfront what would happen to their samples and genetic information if the biobank were to close. Those who perceived personal ownership of specimens were less likely to allow ongoing use of samples after biobank closure, independent of other factors. Creating a plan for specimens in the event of closure is important, as is disclosing this plan to participants during the informed consent process.

Su1380 Complications of IBD in the Anti-TNF Era: Reason for Optimism?

P528 Complications of IBD in the anti-TNF era: reason for optimism? V. Nuij1 *, G. Fuhler1, A. Edel1, R. Ouwendijk2, M. Rijk3, R. Beukers4, R. Quispel5, A. van Tilburg6, T. Tang7, H. Smalbraak8, K. Bruin9, F. Lindenburg10, L. Peyrin-Biroulet11, C.J. van der Woude1. 1ErasmusMC University Medical Center, Gastroenterology and Hepatology, Rotterdam, Netherlands, 2Ikazia Hospital, Gastroenterology and Hepatology, Rotterdam, Netherlands, 3Amphia Hospital, Gastroenterology and Hepatology, Breda, Netherlands, 4Albert Schweitzer Hospital, Gastroenterology and Hepatology, Rotterdam, Netherlands, 5Reinier de Graaf Gasthuis, Gastroenterology and Hepatology, Rotterdam, Netherlands, 6Sint Franciscus Gasthuis, Gastroenterology and Hepatology, Rotterdam, Netherlands, 7 IJsselland Hospital, Gastroenterology and Hepatology, Capelle aan den IJssel, Netherlands, 8Lievensberg Hospital, Internal Medicine, Bergen op Zoom, Netherlands, 9Tweesteden Hospital, Gastroenterology and Hepatology, Tilburg, Netherlands, 10Franciscus Hospital, Gastroenterology and Hepatology, Roosendaal, Netherlands, 11Nancy University Hospital, Universite de Lorraine, Gastroenterology and Hepatology, Vandoeuvre-les-Nancy, France