Christophe Poirier

Molecular map of Chromosome 19 including three genes affecting bleeding time: ep, ru , and bm

The mouse ruby eye (ru) and pale ear (ep) pigment dilution genes cause platelet storage pool deficiency (SPD) and prolonged bleeding times. The brachymorphic (bm) gene, in addition to causing skeletal abnormalities, is also associated with prolonged bleeding times. All three hemorrhagic genes are found within 10 cM on Chromosome (Chr) 19. In this study, 15 microsatellite markers and five cDNAs, spanning 21 cM of Chr 19, were mapped in relation to the bm, ep, and ru genes in 457 progeny of an interspecific backcross utilizing the highly inbred strain PWK derived from the Mus musculus musculus species. Several markers were found to be closely linked to the three genes and should be useful as entry points in their eventual molecular identification.

The mouse mutation muscle deficient (mdf) is characterized by a progressive motoneuron disease

Abstract. Muscle deficient (mdf) is an autosomal-recessive mutation mapped to mouse chromosome 19. The clinical phenotype and the muscle histopathology, briefly described in 1980, and the nervous system histopathology are detailed in the present study. Homozygotes develop a posterior waddle at 4 to 8 weeks of age. Soon thereafter, the hindlimbs become paralyzed and weakness appears in forelimbs, leading to a serious disability. The disease progresses slowly and the mean lifespan is reduced to 8 months. Skeletal muscles exhibit a neurogenic atrophy with signs of reinnervation. Peripheral nerves display axonal degeneration. Neurons within the spinal cord ventral horn, and some motor nuclei of the brain stem, are affected by a cytoplasmic vacuolar degeneration. Ascending and descending spinal cord tracts appear normal. An astrogliosis, restricted to the ventral horn of the spinal cord, occurs in mdftmdf mice of 10 weeks of age. These clinical and histological features are indicative of a progressive motor neuronopathy. Among the murine spinal muscular atrophies, the programmed cell death of the mdf motoneurons is morphologically similar to wobbler. Because of the long time course, the mdf mutation may represent a valuable tool for understanding juvenile motoneuron diseases with chronic evolution, even though the murine locus is not syntenic with the human ones.

Spontaneous muscular dystrophy caused by a retrotransposal insertion in the mouse laminin α2 chain gene

We identified a novel spontaneous mouse model of human congenital muscular dystrophy with laminin alpha2 chain deficiency, named dy(Pas)/dy(Pas). Homozygous animals rapidly developed a progressive muscular dystrophy leading to premature death. Immunohistological and biochemical analyses demonstrated the absence of laminin alpha2 chain expression in skeletal muscle. Analysis of the laminin alpha2 chain cDNA showed the insertion of the long terminal repeat of an intracisternal A-particle gene. In addition, a 6.1 kb insertion composed of retrotransposon elements was identified in the Lama2 sequence. The dy(Pas)/dy(Pas) mouse is thus the first spontaneous mutant with a complete laminin alpha2 chain deficiency in which the mutation has been identified.

A high-resolution genetic map of mouse Chromosome 19 encompassing the muscle-deficient osteochondrodystrophy (mdfocd) region

Muscle deficient (mdf) is an autosomal recessive mutation of the neuromuscular type which arose spontaneously in 1974, in a C57BL/6 colony, at The Jackson Laboratory (Womack et al. 1980). Homozygotes for this mutation can first be detected at 5-6 weeks of age when they exhibit a waddling gait and, occasionally, a nervous tremor. At the histological level we have shown that this mutation is characterized by a progressive motor neuron degeneration (Blot et al. 1995) inducing (or associated with) an intense degeneration of both type I and type II muscle fibers. Fertility of females is low, and males are sterile. Osteochondrodystrophy (ocd) is another spontaneous recessive mutation which arose in 1980, in a C3H colony, also at The Jackson Laboratory. Homozygotes for ocd have a reduced body size with disproportionately shortened long bones. The syndrome appears to be the consequence of an abnormal organization of the proliferative zone of the cartilage (Sweet and Bronson 1991). Homozygous females are fertile. It would be of interest to identify the product of the +°df allele at the molecular level because this protein is clearly implicated in the maintenance of motor neuron integrity. We then decided to undertake the positional cloning of this gene and began by the establishment of a high-resolution molecular map of the mdfcontaining region. From published linkage data (Sweet 1983; Sweet and Bronson 1991) we knew that mdf and ocd mapped to the centromeric region of mouse Chromosome (Chr) 19. Given that these two mutant alleles have easily distinguishable phenotypes and considering the fact that they originated on two different inbred backgrounds, we decided to set an intraspecific repulsion intercross. We mated C57BL/6-mdf (+Imdf) males to C3HIHe-ocd (ocd/ocd) females. By test progeny with (+Imdf) mice, we selected F 1 mice carrying both mutations; these selected mice were then intercrossed. This strategy had the advantage of incorporating the two mutations in a single consensus molecular map. For the genotyping of the offspring we used all the microsatellites already reported as polymorphic between the parental strains (Dietrich et al. 1994). We also used a recently identified polymorphic microsatellite located within the second intron of the Fosl1 gene (Schreiber et al. 1997) as well as an RFLP generated by BglII and identified with the cDNA of the Fau gene (C57BL/6 = 4.1 kb; C3H = 3.7 kb; Casteels et al. 1995). Taking advantage of

The cDNA sequence of mouse uroporphyrinogen III synthase and assignment to mouse chromosome 7

Uroporphyrinogen lII synthase [URO-synthase, also called hydroxymethylbilane hydro-lyase (cyclizing), EC 4.2.175] is the fourth enzyme of the heme biosynthetic pathway. In humans, the defect in uroporphyrinogen III synthase (UROIIIS) is responsible for congenital erythropoietic porphyria (CEP) or Gt~nthers disease, which is inherited as an autosomal recessive trait (Kappas et al. 1989). In patients, enzyme activity is decreased by 80-98%, and different molecular lesions have been described: six exonic point mutations (L04F, P53L, T62A, A66V, C73R, and T228M), one insertion of 80 bp, and one deletion (del 148-245; Deybach et al. 1990; Boulechfar et al. 1992; Warner et al. 1992). These analyses became possible after the publication of human UROIIIS cDNA sequence (Tsai et al. 1988). However, the full genomic sequence for UROIIIS has not yet been published. In human, the UROS gene has been mapped to Chromosome (Chr) 10 q25.2@6.3 (Astrin et al. 1991). In genetic diseases such as porphyrias, animal models of the disease represent useful tools in many fields (Smithies 1993), because the physiopathological studies can be readily undertaken in animals when invasive methods are needed. Further, an animal model is easier to handle when a large number of inbred mice are necessary to study gene regulation in a given genetic background, or to establish phenotype-genotype correlations. As a first step

MAPPING, CLONING, CDNA SEQUENCE, AND EXPRESSION OF THE GENE ENCODING THE MOUSE MICROMOLAR CALPAIN LARGE SUBUNIT (CAPN1)

Unite de Genetique des Mammiferes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France 2Laboratoire de Biochimie et Technologie des Aliments, Institut des Sciences et Techniques des Aliments de Bordeaux, Universite Bordeaux I, Avenue des Facultes, 33405 Talence Cedex, France 3Unite de Genetique de la Differenciation, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France 4Laboratorie de Developpement cellulaire, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France

The mouse homologs of human GIF, DDB1, and CFL1 genes are located on chromosome 19.

Species: Mouse Locus name: Mouse p127 subunit of damage-specific DNA binding protein, mouse gastric intrinsic factor, and mouse cofilin 1 (non-muscle isoform). Locus symbol: Ddbl, Gif, cfll. Map position: Mouse Chromosome 19 Methods of mapping: Fluorescent in situ hybridization (FISH) on mouse SV22-CD cell line metaphase chromosomes [1]. Mouse x hamster somatic cell hybrids analysis. Molecular reagents: The human 4.2-kb DDB 1 cDNA [21 was labeled with biotinylated-14-dUTP and nick-translation kit GIBCO BRL (No. 8247 SA), hybridized (200 ng per slide) in the presence of 10 p.g of mouse Cotl DNA (Life TechnologiesGIBCO BRL, Cergy Pomtoise, France), and revealed by avidinFITC (Vector Laboratories) as previously described [3]. Metaphase spreads were analyzed under an Axiophot (Zeiss) microscope (Fig. 1). For Gif we have selected a pair of primers allowing amplification of a 120-bp fragment of exon 1 (GeneBank Acc # L24192) on mouse DNA. Gif-a: 5 aag tgc aca cag gag aag gta gag Gif-z: 5 cac agc cca gag aac act tag ga. A pair of primers for Cfll was selected on mouse EST sequence (GeneBank Acc #W09648) and allowed amplification of a 195-bp fragment on mouse DNA. COI-a: 5 caa cct atg aga cca agg aga gca Cfll-z: 5 ctt gac ctt cct cgt agc agt tag PCR was performed as previously described. Previously identified homologs: Human homologs [2, 4, 5]. CFL1 homologs: Gallus domesticus destrin gene (SWISSPROT Acc #P18359). GIF homolog: rat Gif gene (GenBank Acc #D45200, J03577). Discussion: FISH experiment performed with the human DDB1 cDNA has shown a specific and recurrent signal on mouse Chr 19 only, near the centromere. We thus concluded that the mouse ortholog for DDB1 is located on the pericentromeric region of mouse Chr 19 (Fig. 1). For Gif and Cfll genes, PCR was carried out on a somatic cell hybrids panel [9] and allowed the mapping of these two genes on mouse Chr 19. These three genes might be used as landmarks in comparative mapping studies [6] and as candidate genes for mouse mutant loci located on mouse Chr 19 [7]. Our finding validates the approach relying on searching genes in syntenic regions known to be conserved between human and mouse and supports the high degree of homology between human 11g13 and mouse Chr 19 [8].

THE C1 INHIBITOR ENCODING GENE (C1NH) MAPS TO MOUSE CHROMOSOME 2

Species: Mouse Locus name: Cl inhibitor gene Locus symbol: C1nh Map position: mapping data were analyzed with RI Manager software [1]. Distances are expressed in cM with 95% confidence interval. AKXL: Mpmv14-11.11 [3.1-26.1]—Clnh-17.65 [6.834.5]—Rapla-ps2 BXD: D2Ncvs2-5 [0.6-16.91—Clnh-4 [0.513.7]—Mdk Method of mapping: AKXL and BXD Recombinant Inbred Strains sets. Two-color FISH with a human YAC yRP-8B9 (green signal) containing the human homolog of C1nh [2] and a mouse YAC specific for Chr 2 (red signal) [3]. Database deposition information: MGD accession number MGDJNUM-41338. Molecular reagents used for mapping: from the cDNA sequence (AF010254) we selected a pair of primers allowing amplification of 440 bp from exon 8 of Clnh: forward 5 GAATTCTTGACTTCACTTA 3 reverse 5 ATTTGTAGAGTTTGATAGGT 3. Method of allele detection: polymorphisms between AKR and C57L and between DBA/2 and C57BL/6 were searched by using FAMA [4]. The forward and reverse primers were end labeled with dyes phosphoramidites 6-FAM and HEX respectively for a second round of amplification. Heteroduplexes were formed and an A/T polymorphism was revealed by mismatch cleavage with the osmium tetroxide/piperidine reaction [4]. This polymorphism is a conservative change within codon Arg 498 at position 1560 of the cDNA sequence deposited (A for C57BL/6 and C57L; T for DBA/2 and AKR). Previously identified homologs: human C1NH [5]. Discussion: the human homolog of C1nh has been mapped to 11g13 [5], its location has been refined about 3.5 Mb centromeric to CNTF [21, whose murine homolog has been mapped to Chr 19 [6]. The human 11g12-q 13 genomic region shares conserved synteny (from centromere to telomere) with mouse Chrs 2, 19, and 7 respectively. Our data suggest that the breakpoint of homology between human 11g12-q13 genomic region and mouse Chrs 2 and 19 is located between C1NH and CNTF. To date no genes have been mapped within this interval, which spans approximately 3.5 megabases. Further characterization of this human genomic region should help to understand the evolution of this region.

Isolation and mapping of three STSs on mouse Chromosome 19

Species: Mouse Loci symbols: D19Car1, D19Car3, and D19Car4 Map position: D19Mit5-2.50 +_ 2.47-D19Car3, D19Car4-9.09 +_ 6.13-D19Ndsl, D19Ndsl-2.99 + 2.08-D19Pas4-3.85 +_ 3.77D19Car1. (Fig. 1). Methods of mapping: D19Carl, D19Car3, and D19Car4 were assigned to Mouse Chromosome (Chr) 19 by use of a mouse x hamster somatic cell hybrid panel [1], and were genetically mapped by SSCP (Single Strand Conformation Polymorphism) analysis [2] from interspeciflc backcrosses between laboratory strains and SEG (D19Car1) and between laboratory strains and PWK, an inbred strain derived from the Mus musculus musculus species, (D19Car3 and D19Car4). Molecular reagents: For somatic cell hybrid analysis and genetic linkage analysis, couples of oligonucleotides were designed to amplify by PCR a 181-pb sequence of D19Car1, a 101-pb sequence of D19Car3, and a 251-pb sequence of D19Car4 (Table 1). Discussion: In order to develop a long-range physical map of mouse Chr 19, we have used microsatellite-derived PCR assays to screen YAC libraries. As a significant number of the mouse YACs we have isolated appear to be chimeric, a large number of additional unique probes will be required to establish nonambiguous contigs. Some probes can be generated directly from the ends of the YAC inserts [3] or derived from IRS-PCR products of these YACs [4], but the high rate of chimerism tends to reduce the efficiency of those approaches.