Colin M. Lazarus

Production of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plants.

We report the production of two very long chain polyunsaturated fatty acids, arachidonic acid (AA) and eicosapentaenoic acid (EPA), in substantial quantities in a higher plant. This was achieved using genes encoding enzymes participating in the ω3/6 Δ8-desaturation biosynthetic pathways for the formation of C20 polyunsaturated fatty acids. Arabidopsis thaliana was transformed sequentially with genes encoding a Δ9-specific elongating activity from Isochrysis galbana, a Δ8-desaturase from Euglena gracilis and a Δ5-desaturase from Mortierella alpina. Instrumental in the successful reconstitution of these C20 polyunsaturated fatty acid biosynthetic pathways was the I. galbana C18-Δ9-elongating activity, which may bypass rate-limiting steps present in the conventional Δ6-desaturase/elongase pathways. The accumulation of EPA and AA in transgenic plants is a breakthrough in the search for alternative sustainable sources of fish oils.

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.

The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Auxin transport through non-hair cells sustains root-hair development

The plant hormone auxin controls root epidermal cell development in a concentration-dependent manner. Root hairs are produced on a subset of epidermal cells as they increase in distance from the root tip. Auxin is required for their initiation and continued growth, but little is known about its distribution in this region of the root. Contrary to the expectation that hair cells might require active auxin influx to ensure auxin supply, we did not detect the auxin-influx transporter AUX1 in root-hair cells. A high level of AUX1 expression was detected in adjacent non-hair cell files. Non-hair cells were necessary to achieve wild-type root-hair length, although an auxin response was not required in these cells. Three-dimensional modelling of auxin flow in the root tip suggests that AUX1-dependent transport through non-hair cells maintains an auxin supply to developing hair cells as they increase in distance from the root tip, and sustains root-hair outgrowth. Experimental data support the hypothesis that instead of moving uniformly though the epidermal cell layer, auxin is mainly transported through canals that extend longitudinally into the tissue.

Fusarin C biosynthesis in Fusarium moniliforme and Fusarium venenatum

Fragments of polyketide synthase (PKS) genes were amplified from complementary DNA (cDNA) of the fusarin C producing filamentous fungi Fusarium moniliforme and Fusarium venenatum by using degenerate oligonucleotides designed to select for fungal PKS C‐methyltransferase (CMeT) domains. The PCR products, which were highly homologous to fragments of known fungal PKS CMeT domains, were used to probe cDNA and genomic DNA (gDNA) libraries of F. moniliforme and F. venenatum. A 4.0 kb cDNA clone from F. venenatum was isolated and used to prepare a hygromycin‐resistance knockout cassette, which was used to produce a fusarin‐deficient strain of F. venenatum (kb=1000 bp). Similarly, a 26 kb genomic fragment, isolated on two overlapping clones from F. moniliforme, encoded a complete iterative Type I PKS fused to an unusual nonribosomal peptide synthase module. Once again, targeted gene disruption produced a fusarin‐deficient strain, thereby proving that this synthase is responsible for the first steps of fusarin biosynthesis.

Identification of a cDNA encoding a novel C18-Δ9 polyunsaturated fatty acid-specific elongating activity from the docosahexaenoic acid (DHA)-producing microalga, Isochrysis galbana 1

Isochrysis galbana, a marine prymnesiophyte microalga, is rich in long chain polyunsaturated fatty acids such as docosahexaenoic acid (C22:6n‐3, Δ4,7,10,13,16,19). We used a polymerase chain reaction‐based strategy to isolate a cDNA, designated IgASE1, encoding a polyunsaturated fatty acid‐elongating activity from I. galbana. The coding region of 263 amino acids predicts a protein of 30 kDa that shares only limited homology to animal and fungal proteins with elongating activity. Functional analysis of IgASE1, by expression in Saccharomyces cerevisiae, was used to determine its activity and substrate specificity. Transformed yeast cells specifically elongated the C18‐Δ9 polyunsaturated fatty acids, linoleic acid (C18:2n‐6, Δ9,12) and α‐linolenic acid (C18:3n‐3, Δ9,12,15), to eicosadienoic acid (C20:2n‐6, Δ11,14) and eicosatrienoic acid (C20:3n‐3, Δ11,14,17), respectively. To our knowledge this is the first time such an elongating activity has been functionally characterised. The results also suggest that a major route for eicosapentaenoic acid (C20:5n‐3, Δ5,8,11,14,17) and docosahexaenoic acid syntheses in I. galbana may involve a Δ8 desaturation pathway.

Biosynthesis of the 2-pyridone Tenellin in the insect pathogenic fungus Beauveria bassiana

Genomic DNA from the insect pathogenic fungus Beauveria bassiana was used as a template in a PCR with degenerate primers designed to amplify a fragment of a C‐methyl transferase (CMeT) domain from a highly reduced fungal polyketide synthase (PKS). The resulting 270‐bp PCR product was homologous to other fungal PKS CMeT domains and was used as a probe to isolate a 7.3‐kb fragment of genomic DNA from a BamH1 library. Further library probing and TAIL‐PCR then gave a 21.9‐kb contig that encoded a 12.9‐kb fused type I PKS–NRPS ORF together with ORFs encoding other oxidative and reductive enzymes. A directed knockout experiment with a BaR cassette, reported for the first time in B. bassiana, identified the PKS–NRPS as being involved in the biosynthesis of the 2‐pyridone tenellin. Other fungal PKS–NRPS genes are known to be involved in the formation of tetramic acids in fungi, and it thus appears likely that related compounds are precursors of 2‐pyridones in fungi. B. bassiana tenellin KO and WT strains proved to be equally pathogenic towards insect larvae; this indicated that tenellin is not involved in insect pathogenesis.

Functional identification of a fatty acid Δ5 desaturase gene from Caenorhabditis elegans

We have identified a cDNA from the nematode worm Caenorhabditis elegans that encodes a fatty acid Δ5 desaturase. Saccharomyces cerevisiae expressing the full‐length cDNA was able to convert di‐homo‐γ‐linolenic acid to arachidonic acid, thus confirming Δ5 desaturation. The 1341 bp Δ5 desaturase sequence contained an N‐terminal cytochrome b 5 domain and was located within a kilobase of the C. elegans Δ6 desaturase on chromosome IV. With an amino acid identity of 45% it is possible that one of these genes arose from the other by gene duplication. This is the first example of a Δ5 desaturase gene isolated from an animal.

Authentic Heterologous Expression of the Tenellin Iterative Polyketide Synthase Nonribosomal Peptide Synthetase Requires Coexpression with an Enoyl Reductase

The tenS gene encoding tenellin synthetase (TENS), a 4239‐residue polyketide synthase nonribosomal‐peptide synthetase (PKS‐NRPS) from Beauveria bassiana, was expressed in Aspergillus oryzae M‐2‐3. This led to the production of three new compounds, identified as acyl tetramic acids, and numerous minor metabolites. Consideration of the structures of these compounds indicates that the putative C‐terminal thiolester reductase (R) domain does not act as a reductase, but appears to act as a Dieckmann cyclase (DKC). Expression of tenS in the absence of a trans‐acting ER component encoded by orf3 led to errors in assembly of the polyketide component, giving clues to the mode of programming of highly reducing fungal PKS. Coexpression of tenS with orf3 from the linked gene cluster led to the production of a correctly elaborated polyketide. The NRPS adenylation domain possibly shows the first identified fungal signature sequences for tyrosine selectivity.

Arachidonic Acid: An Evolutionarily Conserved Signaling Molecule Modulates Plant Stress Signaling Networks

Oomycete pathogens contain arachidonic acid (AA), an elicitor of defense responses and programmed cell death in plants. Arabidopsis plants engineered to produce AA, or exogenously treated with this fatty acid, displayed altered resistance to biotic challengers resulting from AA’s action on salicylate and jasmonate stress signaling networks. Fatty acid structure affects cellular activities through changes in membrane lipid composition and the generation of a diversity of bioactive derivatives. Eicosapolyenoic acids are released into plants upon infection by oomycete pathogens, suggesting they may elicit plant defenses. We exploited transgenic Arabidopsis thaliana plants (designated EP) producing eicosadienoic, eicosatrienoic, and arachidonic acid (AA), aimed at mimicking pathogen release of these compounds. We also examined their effect on biotic stress resistance by challenging EP plants with fungal, oomycete, and bacterial pathogens and an insect pest. EP plants exhibited enhanced resistance to all biotic challenges, except they were more susceptible to bacteria than the wild type. Levels of jasmonic acid (JA) were elevated and levels of salicylic acid (SA) were reduced in EP plants. Altered expression of JA and SA pathway genes in EP plants shows that eicosapolyenoic acids effectively modulate stress-responsive transcriptional networks. Exogenous application of various fatty acids to wild-type and JA-deficient mutants confirmed AA as the signaling molecule. Moreover, AA treatment elicited heightened expression of general stress-responsive genes. Importantly, tomato (Solanum lycopersicum) leaves treated with AA exhibited reduced susceptibility to Botrytis cinerea infection, confirming AA signaling in other plants. These studies support the role of AA, an ancient metazoan signaling molecule, in eliciting plant stress and defense signaling networks.

Late stage oxidations during the biosynthesis of the 2-pyridone tenellin in the entomopathogenic fungus Beauveria bassiana.

Late stage oxidations during the biosynthesis of the 2-pyridone tenellin in the insect pathogenic fungus Beauveria bassiana were investigated by a combination of gene knockout, antisense RNA, and gene coexpression studies. Open reading frames (ORF) 3 and 4 of the tenellin biosynthetic gene cluster were previously shown to encode a trans-acting enoyl reductase and a hybrid polyketide synthase nonribosomal peptide synthetase (PKS-NRPS), respectively, which together synthesize the acyltetramic acid pretenellin-A. In this work, we have shown that ORF1 encodes a cytochrome P450 oxidase, which catalyzes an unprecedented oxidative ring expansion of pretenellin-A to form the 2-pyridone core of tenellin and related metabolites, and that this enzyme does not catalyze the formation of a hydroxylated precursor. Similar genes appear to be associated with PKS-NRPS genes in other fungi. ORF2 encodes an unusual cytochrome P450 monooxygenase required for the selective N-hydroxylation of the 2-pyridone which is incapable of N-hydroxylation of acyltetramic acids.