D. G. Knorre

Photoaffinity labeling as an approach to study supramolecular nucleoprotein complexes

The modern approaches for studying the detailed structure of nucleoprotein complexes involved in replication and transcription, based on the use of nucleic acids with photoreactive groups incorporated into definite positions of polynucleotide chain, are considered. Methods of preparation of photoreactive nucleic acids of this type are presented. Their use for positioning of RNA polymerase III and transcription factors as well as of the main participants of the replication machinery at the respective templates is described. A survey of the data concerning the amino acid residues modified in the course of photoaffinity labeling of proteins is also presented and some complications are discussed.

Complementary addressed modification of double-stranded DNA within a ternary complex

Double‐stranded DNA containing a d(pG)18·d(pC)18 sequence was shown to be selectively alkylated in the vicinity of this fragment using the 5′‐p‐(N‐2‐chloroethyl‐N‐methylamino)benzylamide of deoxyribooligocytidylate, CIRCH2NH(pdC) n (n = 9, 15), in conditions favouring triple‐stranded complex formation.

N-(2-Hydroxyethyl)phenazinium derivatives of oligonucleotides as effectors of the sequence-specific modification of nucleic acids with reactive oligonucleotide derivatives

It has been found that mono‐ and especially diphenazinium derivatives of oligonucleotides complementary to the DNA sequence adjacent to the target sequence of the addressed alkylation of DNA, significantly enhance the extent and specificity of alkylation with p‐(N‐2‐chloroethyl‐N‐methylamino)benzylamide derivatives of the addressing oligonucleotides, thus playing the role of effector of the sequence‐specific (complementary addressed) modification.

Reactive oligonucleotide derivatives and sequence-specific modification of nucleic acids.

Selective modification of nucleic acid base sequences can be achieved by complementary oligonucleotides carrying reactive groups. Different types of reactive groups are briefly presented.

The influence of the target structure on the efficiency of alkylation of single‐stranded DNA with the reactive derivatives of antisense oligonucleotides

Site‐directed alkylation of three oligonucleotide targets: 41‐mer (hairpin structure), 22‐mer (loop part of this hairpin) and 10‐mer (part of the loop) with 5′‐p‐(N‐2‐chloroethyl‐N‐methylamino)benzylamides of oligonucleotides complementary to the loop region was studied. Thermodynamic parameters of the interaction were estimated using the dependence of the limit modification extent on the reagent concentration at several temperatures. The stability of the complex increases significantly in the set: 302‐mer carrying above hairpin, 41‐mer, 22‐mer, the data for 22‐mer and 10‐mer being nearly identical. This indicates significant influence of the loop supporting structure on the interaction with antisense reagents.

Thermodynamic Analysis of Stacking Hybridization of Oligonucleotides with DNA Template

Abstract Contiguous stacking hybridization of oligodeoxyribonucleotides with DNA as template was investigated using three types of complexes: oligonucleotide contiguously stacked with the stem of the preformed minihairpin (complexes I), oligonucleotide tandems containing two (complexes II) or three (complexes III) short oligomers with a common DNA template. Enthalpy ΔH° and entropy ΔS° of the coaxial stacking of adjacent duplexes were determined for GC/G*pC, GT/A*pC, AC/G*pT, AT/A*pT, CT/A*pG, AG/C*pT, AA/T*pT and TT/A*pA nicked (*) dinucleotide base pairs. The maximal efficiency of co-operative interaction was found for the GC/G*pC interface (ΔG°NN/N*pN=-2.7 kcal/mol) and the minimal one for the AA/T*pT interface (ΔG°/NN/N*pN=-1.2 kcal/mol) at 37 °C. As a whole, the efficiency of the base pairs interaction ΔG°NN/N*pN in the nick is not lower than that within the intact DNA helix ΔG°NN/NN). These observed the ΔG°NN/N*pN values are proposed may include the effect of the partial removal of fraying at the adjacent helix ends additionally to the effect of the direct stacking of the terminal base pairs in the duplex junction (ΔG°NN/NN. The thermodynamic parameters have been found to describe adequately the formation of all tandem complexes of the II and III types with oligonucleotides of various length and hybridization properties. The performed thermodynamic analysis reveals features of stacking oligonucleotide hybridization which allow one to predict the temperature dependence of association of oligonucleotides and the DNA template within tandem complexes as well as to determine optimal concentration for formation of these complexes characterized by high co-operativity level.

Kinetic study of the addressed modification by hemin derivatives of oligonucleotides

Kinetics of oligonucleotide pd(TGAATGGGAAGA) modification by a hemin derivative of the complementary oligonucleotide pd(TTCCCATT) in the presence of hydrogen peroxide was investigated. The treatment of experimental data permitted to evaluate the association and rate constants at 25 degrees C: Kx = (3.40 +/- 0.38) x 10(5) M-1 (association constant of the reagent with the target), kd = 152 +/- 6 M-1 min-1 (degradation constant of the hemin group of the reagent in a parallel reaction), ko = 51.0 +/- 1.7 M-1 min-1 (target modification constant in the reactive duplex). The modification of DNA is incomplete due to competition of the modification reaction with the degradation of the hemin group of the reagent in a parallel reaction.

DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

Abstract Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

Location of Template on the Human Ribosome as Revealed from Data on Cross-Linking with Reactive mRNA Analogs

In this review we summarize data on the location of template on the human ribosome that we obtained from cross-linking (affinity labeling) experiments using reactive mRNA analogs. Types of mRNA analogs, model complexes of these analogs with 80S ribosomes, and methods for analysis of the ribosomal components (proteins and rRNA nucleotides) cross-linked with the mRNA analogs are reviewed. From analysis of the cross-linking data, we suggest a scheme for the arrangement of mRNA on the human ribosome and compare the organization of the mRNA binding center on human and Escherichia coli ribosomes.

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2−, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.