Darren J. Newton

The second to fourth digit ratio and variation in the androgen receptor gene

Abstract The second to fourth digit ratio (2D:4D) is sexually dimorphic, with lower mean values in males compared to females. It has been suggested that the sex difference in 2D:4D is determined prenatally, 2D:4D is negatively related to prenatal testosterone and positively to prenatal oestrogen, and that 2D:4D is a marker for levels of sex steroids during brain organisation. There is growing evidence that many sex-dependent behaviours are correlated with 2D:4D. However, there is no direct evidence for an effect of prenatal sex steroids on the digit ratio. The response to prenatal testosterone is dependent on the amount produced and the foetal sensitivity to the hormone. Variation in the X-linked androgen receptor gene (AR) determines sensitivity to testosterone. Alleles of AR with low numbers of CAG triplets respond to testosterone with high transactivational activity, while high numbers of CAGs are associated with increased insensitivity to testosterone. We show in a sample of 50 men (49 Caucasian subjects, 1 Caucasian/Chinese subject) that 2D:4D is a phenotypic correlate of AR structure. Right-hand 2D:4D was positively correlated with CAG number and individuals with low 2D:4D in their right hand compared to left hand had AR alleles with low CAG numbers. We discuss the implications of our findings for our understanding of the aetiology of 2D:4D, its relationships with sex-dependent behaviours, and the evolutionary implications of variation in 2D:4D and AR.

Immunogenetics shows that not all MBL are equal: the larger the clone, the more similar to CLL.

Chronic lymphocytic leukemia (CLL) -like monoclonal B-cell lymphocytosis (MBL) shares common immunophenotype and cytogenetic abnormalities with CLL, from which it is discriminated by a cutoff value of 5 × 10(9)/L circulating clonal B cells. However, the clonal size in MBL is extremely variable and allows discrimination of two distinct entities (high-count [HC] and low-count [LC]-MBL) based on a cutoff value of 0.5 × 10(9)/L clonal B cells. HC-MBL is associated with lymphocytosis and progresses to CLL requiring treatment at a rate of 1.1% per year, whereas LC-MBL is found in the general population only through high-sensitivity techniques and carries limited, if any, risk of progression. We performed an immunogenetic profiling of 333 cases with CLL-like MBL supplemented by detailed comparisons with CLL, focusing especially on CLL Rai stage 0 (CLL-0). LC- and HC-MBL had similar somatic hypermutation status, yet different IGHV gene repertoires and frequencies of B-cell receptor (BcR) stereotypy. In particular, stereotyped BcRs were infrequent in LC-MBL and were often not CLL specific. In contrast, HC-MBL exhibited clear immunogenetic similarities to CLL-0. These findings indicate that LC-MBL may not represent a true preleukemic condition, thus differing from HC-MBL/CLL-0 in which the identification of factors endowing malignant potential is strongly warranted.

Pulmonary dendritic cells and alveolar macrophages are regulated by γδ T cells during the resolution of S. pneumoniae-induced inflammation

γδ T cells commonly associate with mucosal and epithelial sites, fulfilling a variety of immunoregulatory functions. While lung γδ T cells have well‐characterized pro‐inflammatory activity, their potential role in the resolution of lung inflammation has yet to be explored in any detail. Indeed, given the importance of minimizing inflammation, the cellular mechanisms driving the resolution of lung inflammation are poorly understood. Using a murine model of acute Streptococcus pneumoniae‐mediated lung inflammation, we now show that resolution of inflammation following bacterial clearance is associated with a > 30‐fold increase in γδ T‐cell number. Although inflammation eventually resolves in TCRδ−/− mice, elevated numbers of alveolar macrophages and pulmonary dendritic cells, and the appearance of well‐formed granulomas in lungs of TCRδ−/− mice, together indicated a role for γδ T cells in regulating mononuclear phagocyte number. Ex vivo, both alveolar macrophages and pulmonary dendritic cells were susceptible to lung γδ T cell‐mediated cytotoxicity, the first demonstration of such activity against a dendritic cell population. These findings support a model whereby expansion of γδ T cells helps restore mononuclear phagocyte numbers to homeostatic levels, protecting the lung from the consequences of inappropriate inflammation. Copyright

Delineation of the function of a major gamma delta T cell subset during infection.

γδ T cells play important but poorly defined roles in pathogen-induced immune responses and in preventing chronic inflammation and pathology. A major obstacle to defining their function is establishing the degree of functional redundancy and heterogeneity among γδ T cells. Using mice deficient in Vγ1+ T cells which are a major component of the γδ T cell response to microbial infection, a specific immunoregulatory role for Vγ1+ T cells in macrophage and γδ T cell homeostasis during infection has been established. By contrast, Vγ1+ T cells play no significant role in pathogen containment or eradication and cannot protect mice from immune-mediated pathology. Pathogen-elicited Vγ1+ T cells also display different functional characteristics at different stages of the host response to infection that involves unique and different populations of Vγ1+ T cells. These findings, therefore, identify distinct and nonoverlapping roles for γδ T cell subsets in infection and establish the complexity and adaptability of a single population of γδ T cells in the host response to infection that is not predetermined, but is, instead, shaped by environmental factors.

A subset of IL-10-producing gammadelta T cells protect the liver from Listeria-elicited, CD8(+) T cell-mediated injury

Although γδ T cells play a role in protecting tissues from pathogen‐elicited damage to bacterial, viral and parasitic pathogens, the mechanisms involved in the damage and in the protection have not been clearly elucidated. This has been addressed using a murine model of listeriosis, which in mice lacking γδ T cells (TCRδ–/–) is characterised by severe and extensive immune‐mediated hepatic necrosis. We show that these hepatic lesions are caused by Listeria‐elicited CD8+ T cells secreting high levels of TNF‐α that accumulate in the liver of Listeria‐infected TCRδ–/– mice. Using isolated populations of γδ T cells from wild‐type and cytokine‐deficient strains of mice to reconstitute TCRδ–/– mice, the TCR variable gene 4 (Vγ4)+ subset of γδ T cells was shown to protect against liver injury. Hepatoprotection was dependent upon their ability to produce IL‐10 after TCR‐mediated interactions with Listeria‐elicited macrophages and CD8+ T cells. IL‐10‐producing Vγ4+ T cells also contribute to controlling CD8+ T cell expansion and to regulating and reducing TNF‐α secretion by activated CD8+ T cells. This effect on TNF‐α production was directly attributed to IL‐10. These findings identify a novel mechanism by which pathogen‐elicited CD8+ T cells are regulated via interactions with, and activation of, IL‐10‐producing hepatoprotective γδ T cells.

In Vitro Generation of Long-lived Human Plasma Cells

Plasma cells (PCs), the terminal effectors of humoral immunity, are short-lived unless supported by niche environments in which they may persist for years. No model system has linked B cell activation with niche function to allow the in vitro generation of long-lived PCs. Thus, the full trajectory of B cell terminal differentiation has yet to be investigated in vitro. In this article, we describe a robust model for the generation of polyclonal long-lived human PCs from peripheral blood B cells. After a proliferative plasmablast phase, PCs persist in the absence of cell division, with viability limited only by elective culture termination. Conservative predictions for PC life expectancy are 300 d, but with the potential for significantly longer life spans for some cells. These long-lived PCs are preferentially derived from memory B cells, and acquire a CD138high phenotype analogous to that of human bone marrow PCs. Analysis of gene expression across the system defines clusters of genes with related dynamics and linked functional characteristics. Importantly, genes in these differentiation clusters demonstrate a similar overall pattern of expression for in vitro and ex vivo PCs. In vitro PCs are fully reprogrammed to a secretory state and are adapted to their secretory load, maintaining IgG secretion of 120 pg/cell/day in the absence of XBP1 mRNA splicing. By establishing a set of conditions sufficient to allow the development and persistence of mature human PCs in vitro, to our knowledge, we provide the first platform with which to sequentially explore and manipulate each stage of human PC differentiation.

Evidence for the involvement of lung-specific γδ T cell subsets in local responses to Streptococcus pneumoniae infection

Although γδ T cells are involved in the response to many pathogens, the dynamics and heterogeneity of the local γδ T cell response remains poorly defined. We recently identified γδ T cells as regulators of macrophages and dendritic cells during the resolution of Streptococcus pneumoniae‐mediated lung inflammation. Here, using PCR, spectratype analysis and flow cytometry, we show that multiple γδ T cell subsets, including those bearing Vγ1, Vγ4 and Vγ6 TCR, increase in number in the lungs of infected mice, but not in associated lymphoid tissue. These γδ T cells displayed signs of activation, as defined by CD69 and CD25 expression. In vivo BrdU incorporation suggested that local expansion, rather than recruitment, was the principal mechanism underlying this increase in γδ T cells. This conclusion was supported by the finding that pulmonary γδ T cells, but not αβ T cells, isolated from mice that had resolved infection exhibited lung‐homing capacity in both naive and infected recipients. Together, these data provide novel insights into the origins of the heterogeneous γδ T cell response that accompanies lung infection, and the first evidence that inflammation‐associated γδ T cells may exhibit distinct tissue‐homing potential.

Evidence for the opposing roles of different γδ T cell subsets in macrophage homeostasis

To ensure invading pathogens are eliminated with minimal damage to host tissues it is essential that macrophage activation be tightly regulated. Previously we demonstrated that a subset of γδ T cells (Vγ1+) contributes to resolving pathogen‐induced immune responses by killing activated macrophages. However, the exaggerated macrophage response seen in infected Vγ1+ T cell‐deficient mice suggests that γδ T cells play a broader role in macrophage homeostasis and other subsets might promote macrophage activation. Using a macrophage:γδ T cell co‐culture system we have shown that γδ T cells increase the activity of macrophages activated in vivo by Listeria monocytogenes infection. In a dose‐dependent manner, γδ T cells up‐regulated production of cytokines (TNF‐α, IL‐6, IL‐10) and chemokines (MIP‐1α, MIP‐1β) by Listeria‐elicited macrophages. The ability to increase macrophage cytokine production was prominent among Vγ4+ γδ T cells. Reciprocally, Vγ4+ γδ T cells were activated by Listeria‐elicited macrophages, resulting in production of the anti‐inflammatory cytokine, IL‐10. γδ T cell adoptive transfer experiments showed that Vγ4+ T cells protected TCRδ–/– mice against Listeria‐induced liver injury and necrosis. These findings identify distinct and non‐overlapping roles for γδ T cell subsets in regulating macrophage function during pathogen‐induced immune responses.

Conserved structure and tissue expression of rat eotaxin

The b chemokine, eotaxin, was first identified in bronchoalveolar lavage fluid obtained after allergen challenge of sensitized guinea pigs and was subsequently demonstrated to activate guinea pig eosinophils in vitro and to cause their accumulation into lung and skin in vivo (Jose et al. 1994b). Eotaxin acts selectively on eosinophils and appears to be a major chemokine regulating eosinophil recruitment (Jose et al. 1994a). cDNA sequences for initially guinea pig (Jose et al. 1994a) and subsequently mouse (Rothenberg et al. 1995; Gonzalo 1995) and human eotaxin (Ponath et al. 1996b) were isolated. In order to define more fully the role of chemokines such as eotaxin in regulating tissue eosinophilia in rat models of allergic disease, we determined the structure and tissue expression of rat eotaxin. In initial experiments, oligonucleotide primers based on two areas of high similarity between mouse and guinea pig eotaxin sequences (59 sense primer CTCCAGAGCGCTTCTATTCCT, 39 antisense primer ACTTCTTCTTGGGGTCAGCACA) were used to generate a partial cDNA by reverse transcription-polymerase chain reaction of RNA isolated from rat lung. Lung tissue was excised 3 h post intravenous Sephadex administration, a treatment that induces lung eosinophil recruitment and granulomatous inflammation (Laycock et al. 1986). The nucleotide sequence

Eotaxin and eotaxin receptor (CCR3) expression in Sephadex particle‐induced rat lung inflammation

The β chemokine eotaxin is a potent eosinophil activator and chemoattractant. We examined immunohistochemically eotaxin protein expression in a range of normal rat tissues and in rat lung during Sephadex particle‐induced pulmonary inflammation. The time course of eotaxin expression in lung at various time points after Sephadex administration was related to the appearance of eosinophils in the bronchoalveolar lavage fluid and tissue distribution of eotaxin receptor (CCR3) positive cells. Results showed that eotaxin protein was constitutively expressed by both lung airway epithelial cells and gut epithelial cells in normal tissues in the absence of inflammation. During Sephadex induced pulmonary inflammation, eotaxin expression increased in alveolar macrophages prior to the major increase in eosinophil numbers which reached a peak at 72 h. The pattern of eotaxin pulmonary expression and the location of CCR3 receptor positive cells suggest a chemoattractant gradient resulting in migration firstly into the tissue and subsequently through the airway epithelium into the airways. Treatment of rats with the glucocorticoid dexamethasone or the immunosuppressant cyclosporin A reduced eosinophil entry into lung tissue and airways but had no apparent effect on eotaxin expression in vivo, indicating that both these drugs inhibit eosinophil recruitment either by an eotaxin‐independent mechanism, or by targetting factors that synergise with eotaxin, or an event post eotaxin expression.