David Huen

BioJava: an open-source framework for bioinformatics

Summary: BioJava is a mature open-source project that provides a framework for processing of biological data. BioJava contains powerful analysis and statistical routines, tools for parsing common file formats and packages for manipulating sequences and 3D structures. It enables rapid bioinformatics application development in the Java programming language. Availability: BioJava is an open-source project distributed under the Lesser GPL (LGPL). BioJava can be downloaded from the BioJava website (http://www.biojava.org). BioJava requires Java 1.5 or higher. Contact: andreas.prlic@gmail.com. All queries should be directed to the BioJava mailing lists. Details are available at http://biojava.org/wiki/BioJava:MailingLists.

Genomic analysis of heat-shock factor targets in Drosophila

We have used a chromatin immunoprecipitation-microarray (ChIP-array) approach to investigate the in vivo targets of heat-shock factor (Hsf) in Drosophila embryos. We show that this method identifies Hsf target sites with high fidelity and resolution. Using cDNA arrays in a genomic search for Hsf targets, we identified 141 genes with highly significant ChIP enrichment. This study firmly establishes the potential of ChIP-array for whole-genome transcription factor target mapping in vivo using intact whole organisms.

The multiple-wing-hairs Gene Encodes a Novel GBD-FH3 Domain-Containing Protein That Functions Both Prior to and After Wing Hair Initiation

The frizzled signaling/signal transduction pathway controls planar cell polarity (PCP) in both vertebrates and invertebrates. Epistasis experiments argue that in the Drosophila epidermis multiple wing hairs (mwh) acts as a downstream component of the pathway. The PCP proteins accumulate asymmetrically in pupal wing cells where they are thought to form distinct protein complexes. One is located on the distal side of wing cells and a second on the proximal side. This asymmetric protein accumulation is thought to lead to the activation of the cytoskeleton on the distal side, which in turn leads to each cell forming a single distally pointing hair. We identified mwh as CG13913, which encodes a novel G protein binding domain–formin homology 3 (GBD–FH3) domain protein. The Mwh protein accumulated on the proximal side of wing cells prior to hair formation. Unlike planar polarity proteins such as Frizzled or Inturned, Mwh also accumulated in growing hairs. This suggested that mwh had two temporally separate functions in wing development. Evidence for these two functions also came from temperature-shift experiments with a temperature-sensitive allele. Overexpression of Mwh inhibited hair initiation, thus Mwh acts as a negative regulator of the cytoskeleton. Our data argued early proximal Mwh accumulation restricts hair initiation to the distal side of wing cells and the later hair accumulation of Mwh prevents the formation of ectopic secondary hairs. This later function appears to be a feedback mechanism that limits cytoskeleton activation to ensure a single hair is formed.

Insect Population Control by Homing Endonuclease-Based Gene Drive: An Evaluation in Drosophila melanogaster

Insects play a major role as vectors of human disease as well as causing significant agricultural losses. Harnessing the activity of customized homing endonuclease genes (HEGs) has been proposed as a method for spreading deleterious mutations through populations with a view to controlling disease vectors. Here, we demonstrate the feasibility of this method in Drosophila melanogaster, utilizing the well-characterized HEG, I-SceI. In particular, we show that high rates of homing can be achieved within spermatogonia and in the female germline. We show that homed constructs continue to exhibit HEG activity in the subsequent generation and that the ectopic homing events required for initiating the strategy occur at an acceptable rate. We conclude that the requirements for successful deployment of a HEG-based gene drive strategy can be satisfied in a model dipteran and that there is a reasonable prospect of the method working in other dipterans. In characterizing the system we measured repair outcomes at the spermatogonial, spermatocyte, and spermatid stages of spermatogenesis. We show that homologous recombination is restricted to spermatogonia and that it immediately ceases when they become primary spermatocytes, indicating that the choice of DNA repair pathway in the Drosophila testis can switch abruptly during differentiation.

The Epstein-Barr virus gene BHRF1, a homologue of the cellular oncogene Bcl-2, inhibits apoptosis induced by gamma radiation and chemotherapeutic drugs.

Analysis of apoptosis, active and controllable cell death, has demonstrated that the size of a cell population can be regulated by changes in the cell death rate as well as in the rates of proliferation and differentiation. Factors which alter the rate of cell death, such as expression of the proto-oncogene bcl-2, can therefore directly affect the number of cells within a population. Bcl-2 has been shown to suppress apoptosis in response to a variety of stimuli and to act as a complementary survival signal for the random acquisition of other oncogenic mutations, such as deregulated c-myc. The Epstein Barr virus (EBV) gene BHRF1 was the first of a family of bcl-2 homologues now being identified. BHRF1 and bcl-2 share 25% primary amino acid sequence homology. Here we show that gamma radiation and several cytotoxic anticancer agents induce apoptosis in Burkitts lymphoma (BL) cell lines, as has been found in several other systems. Using gene transfection studies we have also shown that expression of either BHRF1 or bcl-2 in BL cell lines significantly suppresses apoptosis in response to a variety of anticancer treatment. This has confirmed that BHRF1 is functionally homologous to bcl-2 in B-cells and suggests that BHRF1 may act to prevent apoptosis during EBV infection, maximising virus particle production, as has been suggested for other human and insect viral genes. Suppression of chemotherapeutic drug induced cell death by bcl-2 and BHRF1 as demonstrated in this cell system, results in resistance to a variety of different agents and may represent an alternative mechanism by which multidrug resistance arises during chemotherapy.

Development of synthetic selfish elements based on modular nucleases in Drosophila melanogaster

ZFN-AAVS1 Deletions Reference ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT A1 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGG----ATAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -5(+1) A2 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGG----------------ATTGGTGACAGAAAATAACAGGGTAAT -16 A3 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGG----------GACAGGATTGGTGACAGAAAATAACAGGGTAAT -10 [x2] A4 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGG--------GGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -8 B7 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGG-----------ACAGGATTGGTGACAGAAAATAACAGGGTAAT -11 A2* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGGGCC-CTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -1 [x2] A7* ATGCCTAGGGATAAGCCCCTCCACCCCAC-----------TAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -11 B2* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGGG----TAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -4 A5* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGGCC-ACTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -1 [x2] B4* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGG-CCACTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -1 B7* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGG--CACTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -2 Insertions B8 ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGACAGGAAGTTACCTGTTACAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT -8(+19) [x2] A8* ATGCCTAGGGATAAGCCCCTCCACCCCACAGTGGGGCCAACTAGGGACAGGATTGGTGACAGAAAATAACAGGGTAAT +1

Optimising homing endonuclease gene drive performance in a semi-refractory species: the Drosophila melanogaster experience.

Homing endonuclease gene (HEG) drive is a promising insect population control technique that employs meganucleases to impair the fitness of pest populations. Our previous studies showed that HEG drive was more difficult to achieve in Drosophila melanogaster than Anopheles gambiae and we therefore investigated ways of improving homing performance in Drosophila. We show that homing in Drosophila responds to increased expression of HEGs specifically during the spermatogonia stage and this could be achieved through improved construct design. We found that 3′-UTR choice was important to maximise expression levels, with HEG activity increasing as we employed Hsp70, SV40, vasa and βTub56D derived UTRs. We also searched for spermatogonium-specific promoters and found that the Rcd-1r promoter was able to drive specific expression at this stage. Since Rcd-1 is a regulator of differentiation in other species, it suggests that Rcd-1r may serve a similar role during spermatogonial differentiation in Drosophila. Contrary to expectations, a fragment containing the entire region between the TBPH gene and the bgcn translational start drove strong HEG expression only during late spermatogenesis rather than in the germline stem cells and spermatogonia as expected. We also observed that the fraction of targets undergoing homing was temperature-sensitive, falling nearly four-fold when the temperature was lowered to 18°C. Taken together, this study demonstrates how a few simple measures can lead to substantial improvements in the HEG-based gene drive strategy and reinforce the idea that the HEG approach may be widely applicable to a variety of insect control programs.

The design and in vivo evaluation of engineered I-OnuI-based enzymes for HEG gene drive.

The homing endonuclease gene (HEG) drive system, a promising genetic approach for controlling arthropod populations, utilises engineered nucleases to spread deleterious mutations that inactivate individual genes throughout a target population. Previous work with a naturally occurring LAGLIDADG homing endonuclease (I-SceI) demonstrated its feasibility in both Drosophila and Anopheles. Here we report on the next stage of this strategy: the redesign of HEGs with customized specificity in order to drive HEG-induced ‘homing’ in vivo via break-induced homologous recombination. Variants targeting a sequence within the Anopheles AGAP004734 gene were created from the recently characterized I-OnuI endonuclease, and tested for cleavage activity and frequency of homing using a model Drosophila HEG drive system. We observed cleavage and homing at an integrated reporter for all endonuclease variants tested, demonstrating for the first time that engineered HEGs can cleave their target site in insect germline cells, promoting targeted mutagenesis and homing. However, in comparison to our previously reported work with I-SceI, the engineered I-OnuI variants mediated homing with a reduced frequency, suggesting that site-specific cleavage activity is insufficient by itself to ensure efficient homing. Taken together, our experiments take a further step towards the development of a viable HEG-based population control strategy for insects.

Dilated heart failure in transgenic mice expressing the Epstein—Barr virus nuclear antigen-leader protein

The Epstein-Barr virus nuclear antigen-leader protein (EBNA-LP) is required for high efficiency B lymphocyte growth transformation by the virus. To test the potential contribution of EBNA-LP to tumorigenesis in vivo, we produced transgenic mice carrying an EBNA-LP cDNA construct, using the widely expressed metallothionein promoter. Expression of EBNA-LP was detected in liver, kidney, heart, lung and spleen. There were no apparent oncogenic consequences of EBNA-LP expression. Unexpectedly however, at ages ranging from about 4 months to over a year, transgenic mice developed symptoms of congestive heart failure, including left ventricular dilatation, right ventricular hypertrophy, left atrial thrombosis, pulmonary oedema and hydrothorax. Fibrillation was not apparent in the electrocardiograph; however a reduction in T-wave amplitude suggested that the development of an abnormality of ventricular repolarization may precede the manifestation of overt symptoms. The highly predictable development of dilated heart failure in these transgenic mice suggests they may be a useful model for the pathophysiological changes associated with human dilated cardiomyopathy.

On the use of resampling tests for evaluating statistical significance of binding-site co-occurrence

BackgroundIn eukaryotes, most DNA-binding proteins exert their action as members of large effector complexes. The presence of these complexes are revealed in high-throughput genome-wide assays by the co-occurrence of the binding sites of different complex components. Resampling tests are one route by which the statistical significance of apparent co-occurrence can be assessed.ResultsWe have investigated two resampling approaches for evaluating the statistical significance of binding-site co-occurrence. The permutation test approach was found to yield overly favourable p-values while the independent resampling approach had the opposite effect and is of little use in practical terms. We have developed a new, pragmatically-devised hybrid approach that, when applied to the experimental results of an Polycomb/Trithorax study, yielded p-values consistent with the findings of that study. We extended our investigations to the FL method developed by Haiminen et al, which derives its null distribution from all binding sites within a dataset, and show that the p-value computed for a pair of factors by this method can depend on which other factors are included in that dataset. Both our hybrid method and the FL method appeared to yield plausible estimates of the statistical significance of co-occurrences although our hybrid method was more conservative when applied to the Polycomb/Trithorax dataset.A high-performance parallelized implementation of the hybrid method is available.ConclusionsWe propose a new resampling-based co-occurrence significance test and demonstrate that it performs as well as or better than existing methods on a large experimentally-derived dataset. We believe it can be usefully applied to data from high-throughput genome-wide techniques such as ChIP-chip or DamID. The Cooccur package, which implements our approach, accompanies this paper.