David San Segundo

Calcineurin inhibitors, but not rapamycin, reduce percentages of CD4+CD25+FOXP3+ regulatory T cells in renal transplant recipients.

Background. Immunosuppression in renal transplantation, although manageable in the short-term, is a major hurdle for long-term graft survival. Recently, increased frequencies of CD4+CD25high regulatory T cells (Tregs) have been described as an additional mechanism that induces alloimmune tolerance. Methods. We assessed 64 renal transplant recipients with stable renal function for at least one year. Patients were divided into two groups according to the immunosuppression they were receiving at the moment of the study: one consisted of patients receiving rapamycin (Rapa) but not calcineurin inhibitors (CNI), and the other group received CNI but not Rapa. The Rapa group was further divided into three subgroups according to their previous experience with CNI: CNI-free, CNI withdrawal, and CNI conversion. Frequencies of blood Tregs were studied by flow cytometry after staining with monoclonal antibodies specific for different markers of Tregs. Results. Frequencies of CD4+ T cells with regulatory phenotype and function were significantly decreased in peripheral blood of renal transplant patients receiving CNI compared with those receiving Rapa. This effect was independent of an early exposure to CNI because the CNI-free patients in the Rapa group showed similar frequencies of Tregs to the CNI withdrawal and CNI conversion groups. Conclusions. CNI, but not Rapa, induce a decrease of circulating Tregs in stable renal transplant recipients. Thus, Rapa might be further explored in strategies using preservation of Tregs for transplant tolerance. Furthermore, quantification of blood Tregs may be a suitable tool to identify renal transplant recipients who may be candidates for reduced immunosuppression.

PLCG1 mutations in cutaneous T-cell lymphomas

Cutaneous T-cell lymphoma (CTCL) is a heterogeneous group of primary cutaneous T-cell lymphoproliferative processes, mainly composed of mycosis fungoides and Sézary syndrome, the aggressive forms of which lack an effective treatment. The molecular pathogenesis of CTCL is largely unknown, although neoplastic cells show increased signaling from T-cell receptors (TCRs). DNAs from 11 patients with CTCL, both normal and tumoral, were target-enriched and sequenced by massive parallel sequencing for a selection of 524 TCR-signaling-related genes. Identified variants were validated by capillary sequencing. Multiple mutations were found that affected several signaling pathways, such as TCRs, nuclear factor κB, or Janus kinase/signal transducer and activator of transcription, but PLCG1 was found to be mutated in 3 samples, 2 of which featured a redundant mutation (c.1034T>C, S345F) in exon 11 that affects the PLCx protein catalytic domain. This mutation was further analyzed by quantitative polymerase chain reaction genotyping in a new cohort of 42 patients with CTCL, where it was found in 19% of samples. Immunohistochemical analysis for nuclear factor of activated T cells (NFAT) showed that PLCG1-mutated cases exhibited strong NFAT nuclear immunostaining. Functional studies demonstrated that PLCG1 mutants elicited increased downstream signaling toward NFAT activation, and inhibition of this pathway resulted in reduced CTCL cell proliferation and cell viability. Thus, increased proliferative and survival mechanisms in CTCL may partially depend on the acquisition of somatic mutations in PLCG1 and other genes that are essential for normal T-cell differentiation.

Changes in the Serum Levels of Interleukin-17/ Interleukin-23 During Acute Rejection in Liver Transplantation

Interleukin‐23 (IL‐23) and T helper 17 (Th17) cells have been cast as major players in autoimmunity, but their role in transplantation immunity remains to be specified. The aim of our study was to investigate the time course of serum levels of IL‐23 and IL‐17 during hepatic allograft rejection. Serum levels of IL‐23 and IL‐17 were determined in 20 healthy subjects and 50 hepatic transplant recipients. These patients were divided into 2 groups: group I was composed of 15 patients with acute rejection, and group II was composed of 35 patients without acute rejection. Samples were collected on days 1 and 7 after liver transplantation and on the day of liver biopsy. The concentrations of IL‐23 were similar for the rejection group and nonrejection group at early postoperative times. We observed a significant increase in serum IL‐23 levels in the rejection group when a diagnosis of acute rejection had been established. Similarly to IL‐23, at the diagnosis of acute rejection, the concentration of IL‐17 was significantly higher in the rejection group versus the nonrejection group. The whole transplant group, including those with stable graft function, had higher serum levels of IL‐23 and IL‐17 than the controls during the entire postoperative period. In conclusion, IL‐23 and IL‐17 are up‐regulated during acute hepatic rejection. These findings suggest a role for Th17 cells in human liver allograft rejection. Liver Transpl 15:629–633, 2009.

Peripheral Blood Sampling for the Detection of Allograft Rejection: Biomarker Identification and Validation

Currently, acute allograft rejection can only be detected reliably by deterioration of graft function confirmed by allograft biopsy. A huge drawback of this method of diagnosis is that substantial organ damage has already taken place at the time that rejection is diagnosed. Discovering and validating noninvasive biomarkers that predict acute rejection, and chronic allograft dysfunction, is of great importance. Many studies have investigated changes in the peripheral blood in an attempt to find biomarkers that reflect changes in the graft directly or indirectly. Herein, we will review the promises and limitations of the peripheral blood biomarkers that have been described in the literature so far.

ImmuKnow as a diagnostic tool for predicting infection and acute rejection in adult liver transplant recipients: A systematic review and meta‐analysis

Immune status monitoring of transplant recipients could identify patients at risk of acute rejection, infection, and cancer, which are important sources of morbidity and mortality in these patients. The ImmuKnow assay provides an objective assessment of the cellular immune function of immunosuppressed patients. Inconclusive results concerning the ability of the ImmuKnow test to predict acute rejection and infection have raised concerns about the predictive value of ImmuKnow in liver transplant recipients. We conducted a systematic literature review to identify studies published up to March 2012 that documented the use of ImmuKnow for monitoring immune function in liver transplant recipients. The study quality was assessed with the Quality Assessment of Diagnostic Accuracy Studies 2 score. We identified 5 studies analyzing ImmuKnow performance for infection and 5 studies analyzing ImmuKnow performance for acute rejection. The pooled sensitivity, specificity, positive likelihood ratio, diagnostic odds ratio, and area under the summary receiver operating characteristic curve were 83.8% [95% confidence interval (CI) = 78.5%‐88.3%], 75.3% (95% CI = 70.9%‐79.4%), 3.3 (95% CI = 2.8‐4.0), 14.6 (95% CI = 9.6‐22.3), and 0.824 ± 0.034, respectively, for infection and 65.6% (95% CI = 55.0%‐75.1%), 80.4% (95% CI = 76.4%‐83.9%), 3.4 (95% CI = 2.4‐4.7), 8.8 (95% CI = 3.1‐24.8), and 0.835 ± 0.060, respectively, for acute rejection. Heterogeneity was low for infection studies and high for acute rejection studies. In conclusion, the ImmuKnow test is a valid tool for determining the risk of further infection in adult liver transplant recipients. Significant heterogeneity across studies precludes the conclusion that ImmuKnow identifies liver transplant patients at risk for rejection. Liver Transpl 18:1245–1253, 2012.

Two-year follow-up of a prospective study of circulating regulatory T cells in renal transplant patients

San Segundo D, Fernández‐Fresnedo G, Ruiz JC, Rodrigo E, Benito MJ, Arias M, López‐Hoyos M. Two‐year follow‐up of a prospective study of circulating regulatory T cells in renal transplant patients.
Clin Transplant 2010: 24: 386–393.

Pretransplant serum CXCL9 and CXCL10 levels fail to predict acute rejection in kidney transplant recipients receiving induction therapy.

Urinary CXCL9 and CXCL10 levels have been described as up-regulated in kidney transplant recipients (KTRs) during acute rejection (AR), suggesting that urinary CXCR3-binding chemokines may be of predictive and diagnostic value (1, 2). Indeed, high pretransplant serum CXCL9 and CXCL10 levels were found to be associated with lower 5-year graft survival rates and AR within the first year after kidney transplantation, a finding interpreted as suggesting that pretransplant CXCR3-binding chemokine assessment may identify patients at risk for AR and graft loss (3, 4). In the latter two studies, KTRs receiving induction therapy were excluded from the analysis, potentially obscuring the clinical usefulness of these findings, because the majority of KTRs now receive some form of induction therapy (5). To address this issue, we have investigated whether pretransplant serum CXCL9 and CXCL10 levels are also predictive for AR in KTRs receiving basiliximab or alemtuzumab induction therapy as risk stratification based on biomarkers is of great potential benefit for KTRs. Sixty-four KTRs, 44 receiving basiliximab, tacrolimus, and steroids, with azathioprine or mycophenolate mofetil, and 20 receiving alemtuzumab, tacrolimus, and mycophenolate mofetil were enrolled. Of this cohort, 10 patients experienced a biopsy-proven AR episode and 2 patients had an AR episode diagnosed by clinical criteria without biopsy confirmation within the first year after transplantation. Pretransplantserumsampleswereassayed in duplicate for CXCL9 and CXCL10 levels by enzyme-linked immunosorbent assay (R&D Systems, Abingdon, UK) following the manufacturer’s instructions. Total leukocyte CXCR3 (ABI assay ID Hs00171041 m1) and hypoxanthine phosphoribosyltransferase (HPRT) (forward primer TGCTTTCCTTGGTCAGGCAGTA, reverse primer TCCAACAAAGTCTGGCTTATATCCA, and probe TCAAGGTCGCAAGCTTGCTGGTGAAA) gene expression were determined using standard real-time reverse-transcriptase polymerase chain reaction techniques. For statistical analysis, the Mann-Whitney U test was used, and P values less than 0.05 were considered significant. Results in the text are expressed as mean standard deviation. Pretransplant demographics were similar between patients with and without AR, except for gender distribution (data not shown). End-stage renal disease patients had significantly higher CXCL9 levels and similar CXCL10 levels compared with healthy controls (data not shown). When patients were grouped based on the occurrence of AR within 1 year after transplantation, no significant difference in CXCL9 levels (296.4 452.9 vs. 150.1 88.4, P not significant; Fig. 1A) or CXCL10 levels (158.2 91.2 vs. 103.2 32.9, P not significant; Fig. 1B) between nonrejecting patients and patients with AR was observed. Rotondi et al. (4) described cutoff values for CXCL9 and CXCL10 of 272.1 and 133.2 pg/mL, respectively, as useful for identifying patients with higher immunologic risk. To explore the lack of predictive value of CXCL9 and CXCL10 levels for AR in the patient cohort analyzed in this study, separately and combined, we stratified into high and low CXCL9 and CXCL10 levels based on these cutoff values. Only 1 patient had high CXCL9 levels, 20 patients had high CXCL10 levels, and 11 patients had high levels of both (Fig. 1C). The sole patient with high CXCL9 levels did not develop AR, whereas two patients with high CXCL10 levels (10%) and one patient with high levels of both (9%) experienced AR. For the patients with only high CXCL10 levels, it should be noted that CXCL10 levels were just above the cutoff (133.4 and 147.1 pg/mL, respectively). The finding that CXCR3-binding chemokine levels fail to predict AR in alemtuzumab-treated KTRs may be explained by the rapid lymphocyte depletion (6) (Fig. 1D). Consequently, cells responsive to CXCL9 and CXCL10 are lost, confirmed by decreased CXCR3 gene expression (Fig. 1E). Basiliximab does not cause lymphocyte depletion but impairs T-cell activation by interleukin2R -chain blockade (7). Because activation is required for CXCR3 expression (8), basiliximab may prevent CXCR3 expression, rendering T cells unresponsive to CLCL9 and CXCL10 signaling. At the time of writing, two patients lost their grafts, one because of AR and one because of cytomegalovirus infection. The former had CXCL9 and CXCL10 levels below the cutoff values, and the latter had CXCL10 levels above the cutoff value (205.9 pg/mL). The demonstration that pretransplant serum CXCL9 and CXCL10 levels failed to predict AR in patients receiving basiliximab or alemtuzumab induction therapy stresses the importance of performing biomarker studies in patients receiving different immunosuppressive regimens. To be widely applicable, any biomarker should be capable of defining patients at risk irrespective of the immunosuppressive regimen.

Regulatory T cells in renal transplantation and modulation by immunosuppression.

The poor long-term graft survival rate counteracts the important advance that transplantation is for end-stage renal disease patients. This is mainly due to the employment of immunosuppression that inhibits nonspecifically the alloimmune response to avoid graft rejection, but, at the same time, brings a number of adverse effects leading to chronic rejection. Thus, the major goal in transplantation is to reach an absence of immune response towards donor alloantigens without the need of long-term immunosuppressant drugs. In recent years, regulatory T cells, mainly those with a CD4+CD25highFOXP3+ phenotype (named as Tregs), have demonstrated an inhibitory effect on immune responses against donor alloantigens. As a consequence, they are a potential tool in the development of transplant tolerance in vivo. Most of the evidence comes from experimental models, although recent works address the role of Tregs in the clinical arena of transplantation. In such a setting, the coexistence of immunosuppression in almost 100% patients is an essential factor to consider. Recent findings show that different drugs favor the induction and maintenance of Tregs in renal transplant recipients. Among them, mammalian target of rapamycin inhibitors seem to better promote the development of Tregs at present. The present work reviews all the evidence published up to date about Tregs in human renal transplantation with a special focus on the effect of clinical protocols of immunosuppression.

Predictive factors of allosensitization in renal transplant patients switched from calcineurin to mTOR inhibitors

Conversion of kidney‐transplant recipients from calcineurin inhibitors to mTOR inhibitors has been suggested to be a risk factor for increased alloimmune response. We have analyzed the development of new HLA‐antibodies (HLA‐Abs) early after conversion in 184 patients converted in stable phase at our hospital and compared with a control group of nonconverted comparable 63 transplants. Using single‐antigen solid‐phase immunoassay analysis, a preconversion and a 3–6 months postconversion sera were prospectively analyzed in every patient for the appearance of new HLA‐Abs. Renal function at 2 years postconversion and cumulative graft survival were compared between groups. In 16 patients, new HLA‐Abs (3‐DSA and 13‐NonDSA), not present at the moment of conversion, were detected (8.7% vs. 3.1% in the control group). The type of mTORi used, type of CNI preconversion, the presence of steroids, time of conversion, or indication for conversion did not have influence on this effect but the presence of HLA‐Abs before conversion highly correlated with the appearance of new specificities. Patients with de novo HLA‐Abs showed a trend to worst graft function and survival. In conclusion, conversion to mTORi can be followed by early appearance of de novo HLA‐Abs, especially in patients with HLA‐Abs preconversion, and this complication should be screened early after conversion.

Increased numbers of circulating CD8 effector memory T cells before transplantation enhance the risk of acute rejection in lung transplant recipients.

The effector and regulatory T cell subpopulations involved in the development of acute rejection episodes in lung transplantation remain to be elucidated. Twenty-seven lung transplant candidates were prospectively monitored before transplantation and within the first year post-transplantation. Regulatory, Th17, memory and naïve T cells were measured in peripheral blood of lung transplant recipients by flow cytometry. No association of acute rejection with number of peripheral regulatory T cells and Th17 cells was found. However, effector memory subsets in acute rejection patients were increased during the first two months post-transplant. Interestingly, patients waiting for lung transplant with levels of CD8+ effector memory T cells over 185 cells/mm3 had a significant increased risk of rejection [OR: 5.62 (95% CI: 1.08-29.37), p=0.04]. In multivariate analysis adjusted for age and gender the odds ratio for rejection was: OR: 5.89 (95% CI: 1.08-32.24), p=0.04. These data suggest a correlation between acute rejection and effector memory T cells in lung transplant recipients. The measurement of peripheral blood CD8+ effector memory T cells prior to lung transplant may define patients at high risk of acute lung rejection.