Decai Tuo
Chinese Academy of Tropical Agricultural Sciences
Network
Latest external collaboration on country level. Dive into details by clicking on the dots.
Publication
Featured researches published by Decai Tuo.
Virology | 2012
Le Gao; Wentao Shen; Pu Yan; Decai Tuo; Xiaoying Li; Peng Zhou
A chloroplast-localized papaya methionine sulfoxide reductase B1 (PaMsrB1) interacting with Papaya ringspot virus (PRSV) NIa-Pro was identified using a Sos recruitment two-hybrid system (SRS). SRS analysis of several deletion mutants of PRSV NIa-Pro and PaMsrB1 demonstrated that the C-terminal (residues 133-239) fragment of PRSV NIa-Pro and residues 112-175 of PaMsrB1 were necessary for this interaction between PRSV NIa-Pro and PaMsrB1. MsrB1 can repair Met-oxidized proteins damaged by reactive oxygen species (ROS). We confirmed that PRSV infection leads to ROS accumulation and a slight upregulation of level PaMsrB1 mRNA in papaya. This interaction between PaMsrB1 with PRSV NIa-Pro may disturb the import of PaMsrB1 into the chloroplasts. These results suggest that this specific interaction could interfere with PaMsrB1 into the chloroplasts to scavenge ROS caused by PRSV infection. This may be a novel mechanism of PRSV towards the host defense.
Viruses | 2015
Decai Tuo; Wentao Shen; Pu Yan; Xiaoying Li; Peng Zhou
Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.
Journal of Virological Methods | 2014
Wentao Shen; Decai Tuo; Pu Yan; Xiaoying Li; Peng Zhou
Papaya leaf distortion mosaic virus (PLDMV) can infect transgenic papaya resistant to a related pathogen, Papaya ringspot virus (PRSV), posing a substantial threat to papaya production in China. Current detection methods, however, are unable to be used for rapid detection in the field. Here, a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of PLDMV, using a set of four RT-LAMP primers designed based on the conserved sequence of PLDMV CP. The RT-LAMP method detected specifically PLDMV and was highly sensitive, with a detection limit of 1.32×10(-6) μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR, while also requiring significantly less time and equipment. The effectiveness of RT-LAMP and one-step RT-PCR in detecting the virus were compared using 90 field samples of non-transgenic papaya and 90 field samples of commercialized PRSV-resistant transgenic papaya from Hainan Island. None of the non-transgenic papaya tested positive for PLDMV using either method. In contrast, 19 of the commercialized PRSV-resistant transgenic papaya samples tested positive by RT-LAMP assay, and 6 of those tested negative by RT-PCR. Therefore, the PLDMV-specific RT-LAMP is a simple, rapid, sensitive, and cost-effective tool in the field diagnosis and control of PLDMV.
Journal of Virological Methods | 2014
Wentao Shen; Decai Tuo; Pu Yan; Yong Yang; Xiaoying Li; Peng Zhou
Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV), which causes disease symptoms similar to PRSV, threaten commercial production of both non-transgenic-papaya and PRSV-resistant transgenic papaya in China. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay to detect PLDMV was developed previously. In this study, the development of another RT-LAMP assay to distinguish among transgenic, PRSV-infected and PLDMV-infected papaya by detection of PRSV is reported. A set of four RT-LAMP primers was designed based on the highly conserved region of the P3 gene of PRSV. The RT-LAMP method was specific and sensitive in detecting PRSV, with a detection limit of 1.15×10(-6)μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR. Field application of the RT-LAMP assay demonstrated that samples positive for PRSV were detected only in non-transgenic papaya, whereas samples positive for PLDMV were detected only in commercialized PRSV-resistant transgenic papaya. This suggests that PRSV remains the major limiting factor for non-transgenic-papaya production, and the emergence of PLDMV threatens the commercial transgenic cultivar in China. However, this study, combined with the earlier development of an RT-LAMP assay for PLDMV, will provide a rapid, sensitive and cost-effective diagnostic power to distinguish virus infections in papaya.
Viruses | 2014
Decai Tuo; Wentao Shen; Yong Yang; Pu Yan; Xiaoying Li; Peng Zhou
Papaya ringspot virus (PRSV), Papaya leaf distortion mosaic virus (PLDMV), and Papaya mosaic virus (PapMV) produce similar symptoms in papaya. Each threatens commercial production of papaya on Hainan Island, China. In this study, a multiplex reverse transcription PCR assay was developed to detect simultaneously these three viruses by screening combinations of mixed primer pairs and optimizing the multiplex RT-PCR reaction conditions. A mixture of three specific primer pairs was used to amplify three distinct fragments of 613 bp from the P3 gene of PRSV, 355 bp from the CP gene of PLDMV, and 205 bp from the CP gene of PapMV, demonstrating the assay’s specificity. The sensitivity of the multiplex RT-PCR was evaluated by showing plasmids containing each of the viral target genes with 1.44 × 103, 1.79 × 103, and 1.91 × 102 copies for the three viruses could be detected successfully. The multiplex RT-PCR was applied successfully for detection of three viruses from 341 field samples collected from 18 counties of Hainan Island, China. Rates of single infections were 186/341 (54.5%), 93/341 (27.3%), and 3/341 (0.9%), for PRSV, PLDMV, and PapMV, respectively; 59/341 (17.3%) of the samples were co-infected with PRSV and PLDMV, which is the first time being reported in Hainan Island. This multiplex RT-PCR assay is a simple, rapid, sensitive, and cost-effective method for detecting multiple viruses in papaya and can be used for routine molecular diagnosis and epidemiological studies in papaya.
Genome Announcements | 2015
Guangyuan Zhao; Pu Yan; Wentao Shen; Decai Tuo; Xiaoying Li; Peng Zhou
ABSTRACT The complete genome sequence (10,326 nucleotides) of a papaya ringspot virus isolate infecting genetically modified papaya in Hainan Island of China was determined through reverse transcription (RT)-PCR. The virus shares 92% nucleotide sequence identity with the isolate that is unable to infect PRSV-resistant transgenic papaya.
Virus Genes | 2015
Le Gao; Decai Tuo; Wentao Shen; Pu Yan; Xiaoying Li; Peng Zhou
The interaction of papaya eukaryotic translation initiation factor 3 subunit G (CpeIF3G) with Papaya ringspot virus (PRSV) NIa-Pro was validated using a bimolecular fluorescence complementation assay in papaya protoplasts based on the previous yeast two-hybrid assay results. The C-terminal (residues 133–239) fragment of PRSV NIa-Pro and the central domain (residues 59–167) of CpeIF3G were required for effective interaction between NIa-Pro and CpeIF3G as shown by a Sos recruitment yeast two-hybrid system with several deletion mutants of NIa-Pro and CpeIF3G. The central domain of CpeIF3G, which contains a C2HC-type zinc finger motif, is required to bind to other eIFs of the translational machinery. In addition, quantitative real-time reverse transcription PCR assay confirmed that PRSV infection leads to a 2- to 4.5-fold up-regulation of CpeIF3G mRNA in papaya. Plant eIF3G is involved in various stress response by enhancing the translation of resistance-related proteins. It is proposed that the NIa-Pro-CpeIF3G interaction may impair translation preinitiation complex assembly of defense proteins and interfere with host defense.
Protein Expression and Purification | 2018
Wentao Shen; Jie Han; Pu Yan; Jiping Zheng; Lie Zhang; Xiaoying Li; Decai Tuo; Peng Zhou
Plant methionine sulfoxide reductase B1 (MsrB1) protects the photosynthetic apparatus from oxidative damage by scavenging reactive oxygen species to repair Met-oxidized proteins in response to abiotic stresses and biotic attack. Papaya MsrB1 (PaMsrB1) was identified previously to interact with papaya ringspot virus NIa-Pro, and this interaction inhibits the import of PaMsrB1 into the chloroplast. Further functional characterization of PaMsrB1 requires the production of a biologically active purified recombinant protein. In this report, PaMsrB1 as a fusion protein containing an N-terminal maltose-binding protein (MBP) was expressed in Escherichia coli Rosetta (DE3) cells and purified. Production of soluble fusion protein was greater when the cells were cultured at 16 °C than at 37 °C. The Factor Xa protease digested MBP-PaMsrB1 fusion protein and subsequently purified recombinant PaMsrB1 specifically reduced the R-diastereomer of methionine sulfoxide (MetSO) and Dabsyl-MetSO to Met in the presence of dithiothreitol. Eight chloroplast-localized and five non-chloroplast-localized candidate proteins that interact with PaMsrB1 were isolated by affinity chromatography and liquid chromatography coupled to tandem mass spectrometry. The results provide a platform to further understand the anti-oxidative defense mechanism of PaMsrB1.
Virus Genes | 2018
Guangyuan Zhao; Decai Tuo; Pu Yan; Xiaoying Li; Peng Zhou; Wentao Shen
We used green fluorescent protein (GFP)-tagged Papaya leaf distortion mosaic virus (PLDMV-GFP) to track PLDMV infection by fluorescence. The virus-derived small interfering RNAs (vsiRNAs) of PLDMV-GFP were characterized from papaya plants by next-generation sequencing. The foreign GFP gene inserted into the PLDMV genome was also processed as a viral gene into siRNAs by components involved in RNA silencing. The siRNAs derived from PLDMV-GFP accumulated preferentially as 21- and 22-nucleotide (nt) lengths, and most of the 5′-terminal ends were biased towards uridine (U) and adenosine (A). The single-nucleotide resolution map revealed that vsiRNAs were heterogeneously distributed throughout the PLDMV-GFP genome, and vsiRNAs derived from the sense strand were more abundant than those from the antisense strand. The hotspots were mainly distributed in the P1 and GFP coding region of the antisense strand. In addition, 979 papaya genes targeted by the most abundant 1000 PLDMV-GFP vsiRNAs were predicted and annotated using GO and KEGG classification. Results suggest that vsiRNAs play key roles in PLDMV–papaya interactions. These data on the characterization of PLDMV-GFP vsiRNAs will help to provide insight into the function of vsiRNAs and their host target regulation patterns.
Journal of Plant Pathology | 2014
Wentao Shen; Decai Tuo; Yong Yang; Pu Yan; Xiaoying Li; Peng Zhou
Papaya ringspot virus (PRSV) and Papaya leaf distortion mosaic virus (PLDMV) from the family Potyviridae produce similar symptoms in papaya such as foliar mosaic, ringspots and distortion, water soaking streaks on petioles, and ringspots on fruit. PRSV is the most widespread and destructive viral disease damaging papaya production in the world, whereas PLDMV was recently identified in China (Tuo et al., 2013). In March 2014, 23 papaya trees displaying disease symptoms similar to those of PRSV or PLDMV were observed in Haikou (Hainan Island, China). Six samples were co-infected with PRSV and PLDMV, as shown by DAC-ELISA with antisera to PRSV or PLDMV. Mixed infection was subsequently confirmed by RT-PCR using PRSV-specific primers designed in a highly conserved region of gene P3 (P3-F, 5′TTGTGTACGACTTCTCACCGAA3′ and P3-R, 5′CGAATGTCATCCAAAGACT GATGATAAAC3′) and PLDMV-specific primers designed in a highly conserved region of the coat protein (CP) gene (CP-F, 5′GGCATGTGGTTTATGATGCAAGG G3′ and CP-R, 5′GCTCCGTGTTCTCAGTCGCATT3′). DNA fragments of the expected size (613 and 355 bp, respectively) were amplified from each mixed infected sample using PRSV and PLDMV-specific primers, and then cloned and sequenced. BLASTn analysis of the nucleotide sequences obtained from the cloned PCR products showed 99% identity with a PRSV isolate from Hainan (GenBank accession No. EF183499) and 100% identity with a PLDMV isolate from Hainan (GenBank accession no. JX974555) (Lu et al., 2008; Tuo et al., 2013). To our knowledge, this is the first report of mixed infection of PRSV and PLDMV on papaya, prompting the need for evaluating the potential threat of the mixed virus infection to papaya production.