Denise L. Doolan

Acquired immunity to malaria.

SUMMARY Naturally acquired immunity to falciparum malaria protects millions of people routinely exposed to Plasmodium falciparum infection from severe disease and death. There is no clear concept about how this protection works. There is no general agreement about the rate of onset of acquired immunity or what constitutes the key determinants of protection; much less is there a consensus regarding the mechanism(s) of protection. This review summarizes what is understood about naturally acquired and experimentally induced immunity against malaria with the help of evolving insights provided by biotechnology and places these insights in the context of historical, clinical, and epidemiological observations. We advocate that naturally acquired immunity should be appreciated as being virtually 100% effective against severe disease and death among heavily exposed adults. Even the immunity that occurs in exposed infants may exceed 90% effectiveness. The induction of an adult-like immune status among high-risk infants in sub-Saharan Africa would greatly diminish disease and death caused by P. falciparum. The mechanism of naturally acquired immunity that occurs among adults living in areas of hyper- to holoendemicity should be understood with a view toward duplicating such protection in infants and young children in areas of endemicity.

Protection of Humans against Malaria by Immunization with Radiation-Attenuated Plasmodium falciparum Sporozoites

During 1989-1999, 11 volunteers were immunized by the bites of 1001-2927 irradiated mosquitoes harboring infectious sporozoites of Plasmodium falciparum (Pf) strain NF54 or clone 3D7/NF54. Ten volunteers were first challenged by the bites of Pf-infected mosquitoes 2-9 weeks after the last immunization, and all were protected. A volunteer challenged 10 weeks after the last immunization was not protected. Five previously protected volunteers were rechallenged 23-42 weeks after a secondary immunization, and 4 were protected. Two volunteers were protected when rechallenged with a heterologous Pf strain (7G8). In total, there was protection in 24 of 26 challenges. These results expand published findings demonstrating that immunization by exposure to thousands of mosquitoes carrying radiation-attenuated Pf sporozoites is safe and well tolerated and elicits strain-transcendent protective immunity that persists for at least 42 weeks.

A prospective analysis of the Ab response to Plasmodium falciparum before and after a malaria season by protein microarray

Abs are central to malaria immunity, which is only acquired after years of exposure to Plasmodium falciparum (Pf). Despite the enormous worldwide burden of malaria, the targets of protective Abs and the basis of their inefficient acquisition are unknown. Addressing these knowledge gaps could accelerate malaria vaccine development. To this end, we developed a protein microarray containing ∼23% of the Pf 5,400-protein proteome and used this array to probe plasma from 220 individuals between the ages of 2–10 years and 18–25 years in Mali before and after the 6-month malaria season. Episodes of malaria were detected by passive surveillance over the 8-month study period. Ab reactivity to Pf proteins rose dramatically in children during the malaria season; however, most of this response appeared to be short-lived based on cross-sectional analysis before the malaria season, which revealed only modest incremental increases in Ab reactivity with age. Ab reactivities to 49 Pf proteins measured before the malaria season were significantly higher in 8–10-year-old children who were infected with Pf during the malaria season but did not experience malaria (n = 12) vs. those who experienced malaria (n = 29). This analysis also provided insight into patterns of Ab reactivity against Pf proteins based on the life cycle stage at which proteins are expressed, subcellular location, and other proteomic features. This approach, if validated in larger studies and in other epidemiological settings, could prove to be a useful strategy for better understanding fundamental properties of the human immune response to Pf and for identifying previously undescribed vaccine targets.

Safety, tolerability and humoral immune responses after intramuscular administration of a malaria DNA vaccine to healthy adult volunteers.

DNA-based vaccines are considered to be potentially revolutionary due to their ease of production, low cost, long shelf life, lack of requirement for a cold chain and ability to induce good T-cell responses. Twenty healthy adult volunteers were enrolled in a Phase I safety and tolerability clinical study of a DNA vaccine encoding a malaria antigen. Volunteers received 3 intramuscular injections of one of four different dosages (20, 100, 500 and 2500 microg) of the Plasmodium falciparum circumsporozoite protein (PfCSP) plasmid DNA at monthly intervals and were followed for up to twelve months. Local reactogenicity and systemic symptoms were few and mild. There were no severe or serious adverse events, clinically significant biochemical or hematologic changes, or detectable anti-dsDNA antibodies. Despite induction of excellent CTL responses, intramuscular DNA vaccination via needle injection failed to induce detectable antigen-specific antibodies in any of the volunteers.

Induction of CD4+ T cell-dependent CD8+ type 1 responses in humans by a malaria DNA vaccine

We assessed immunogenicity of a malaria DNA vaccine administered by needle i.m. or needleless jet injection [i.m. or i.m./intradermally (i.d.)] in 14 volunteers. Antigen-specific IFN-γ responses were detected by enzyme-linked immunospot (ELISPOT) assays in all subjects to multiple 9- to 23-aa peptides containing class I and/or class II restricted epitopes, and were dependent on both CD8+ and CD4+ T cells. Overall, frequency of response was significantly greater after i.m. jet injection. CD8+-dependent cytotoxic T lymphocytes (CTL) were detected in 8/14 volunteers. Demonstration in humans of elicitation of the class I restricted IFN-γ responses we believe necessary for protection against the liver stage of malaria parasites brings us closer to an effective malaria vaccine.

Profiling humoral immune responses to P. falciparum infection with protein microarrays

A complete description of the serological response following exposure of humans to complex pathogens is lacking and approaches suitable for accomplishing this are limited. Here we report, using malaria as a model, a method which elucidates the profile of antibodies that develop after natural or experimental infection or after vaccination with attenuated organisms, and which identifies immunoreactive antigens of interest for vaccine development or other applications. Expression vectors encoding 250 Plasmodium falciparum (Pf) proteins were generated by PCR/recombination cloning; the proteins were individually expressed with >90% efficiency in Escherichia coli cell‐free in vitro transcription and translation reactions, and printed directly without purification onto microarray slides. The protein microarrays were probed with human sera from one of four groups which differed in immune status: sterile immunity or no immunity against experimental challenge following vaccination with radiation‐attenuated Pf sporozoites, partial immunity acquired by natural exposure, and no previous exposure to Pf. Overall, 72 highly reactive Pf antigens were identified. Proteomic features associated with immunoreactivity were identified. Importantly, antibody profiles were distinct for each donor group. Information obtained from such analyses will facilitate identifying antigens for vaccine development, dissecting the molecular basis of immunity, monitoring the outcome of whole‐organism vaccine trials, and identifying immune correlates of protection.

IMMUNE EFFECTOR MECHANISMS IN MALARIA

Malaria, a disease responsible for immense human suffering, is caused by infection with Plasmodium spp. parasites, which have a very complex life cycle - antigenically unique stages infect different tissues of the body. This review details recent developments in our understanding of immunity both to pre-erythrocytic stage antigens and to erythrocytic stage antigens. The former is largely mediated via CD8(+) T cells and involves IFN-gamma, nitric oxide, IL-12 and natural killer cells; the latter varies (in different hosts and with different parasites) but is largely mediated by antibody, helper T cells, nitric oxide and gammadelta T cells. The recent progress towards clinical trials of vaccine candidates against both the pre-erythrocytic stage and erythrocytic stage is also summarized, in particular the use of heterologous prime/boost strategies for the former and the use of MSP1 as a candidate vaccine for the latter.

Identification of Plasmodium falciparum antigens by antigenic analysis of genomic and proteomic data

The recent explosion in genomic sequencing has made available a wealth of data that can now be analyzed to identify protein antigens, potential targets for vaccine development. Here we present, in the context of Plasmodium falciparum, a strategy that rapidly identifies target antigens from large and complex genomes. Sixteen antigenic proteins recognized by volunteers immunized with radiation-attenuated P. falciparum sporozoites, but not by mock immunized controls, were identified. Several of these were more antigenic than previously identified and well characterized P. falciparum-derived protein antigens. The data suggest that immune responses to Plasmodium are dispersed on a relatively large number of parasite antigens. These studies have implications for our understanding of immunodominance and breadth of responses to complex pathogens.

Degenerate cytotoxic T cell epitopes from P. falciparum restricted by multiple HLA-A and HLA-B supertype alleles.

We recently described human leukocyte antigen (HLA) A2, A3 and B7 supertypes, characterized by largely overlapping peptide-binding specificities and represented in a high percentage of different populations. Here, we identified 17 Plasmodium falciparum peptides capable of binding these supertypes and assessed antigenicity in both vaccinated and naturally exposed populations. Positive cytotoxic T lymphocyte recall and cytokine (interferon-gamma and tumor necrosis factor alpha) responses were detected for all peptides; all were recognized in the context of more than one HLA class I molecule; and at least 12 of the 17 were recognized in the context of all HLA alleles studied. These data validate the concept of HLA supertypes at the biological level, show that highly degenerate peptides are almost always recognized as epitopes, and demonstrate the feasibility of developing a universally effective vaccine by focusing on a limited number of peptide specificities.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

ABSTRACT Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoeliisporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.