Diane E. Miller

Frequent deletions of FHIT and FRA3B in Barrett's metaplasia and esophageal adenocarcinomas.

The FHIT gene, which spans the common fragile site FRA3B, has been shown to produce aberrant transcripts in a variety of tumor types. Homozygous deletions within the FHIT locus have been detected only in tumor-derived cell lines and LOH has been described in numerous primary tumors. Based on these findings and its location on 3p, FHIT has been proposed as a tumor suppressor gene. To further study the relationship of FRA3B to the findings regarding the FHIT gene and to determine the extent of FHIT mRNA alterations in early stages of tumor development, the status of the FHIT gene was evaluated in the premalignant condition of Barretts esophagus and associated esophageal adenocarcinomas. FHIT expression was investigated by RT – PCR in normal esophageal, Barretts metaplasia and adenocarcinoma tissues from 15 patients. Alterations of FHIT transcripts were observed in 12/14 (86%) of Barretts metaplasia and in 14/15 (93%) of the adenocarcinomas from the same patients. Characterization of the altered transcripts revealed FHIT mRNA lacking one or more exons, with deletion of exons 5 – 7 being most frequent. Analysis of genomic DNA from 20 patients showed homozygous deletions involving exon 5 of FHIT in 4/20 (20%) esophageal adenocarcinomas, and 7/20 (35%) tumors demonstrated hemizygous loss. Genomic deletions also involved the BE758-6 locus, indicating that a large region is deleted. Fluorescence in situ hybridization (FISH) analysis demonstrated that this region of deletion is localized within FRA3B. Our results extend the range of tumor types in which altered FHIT transcripts have been demonstrated and show that these alterations can be seen in the premalignant stage of esophageal tumor development. These results indicate that the fragility and recombination-prone nature of FRA3B is related to tumor-specific chromosomal instability affecting the FHIT gene in esophageal adenocarcinoma development.

Molecular characterization of FRAXB and comparative common fragile site instability in cancer cells

The common fragile site, FRA3B, has been shown to be a site of frequent homozygous deletions in some cancers, resulting in loss of expression of the associated FHIT gene. It has been proposed that FHIT is a tumor suppressor gene that is inactivated as a result of the instability of FRA3B in tumorigenesis. More recently, deletions at other common fragile sites, FRA7G and FRA16D, have been identified in a small number of cancer cell lines. Here, we have mapped and molecularly characterized the frequently observed common fragile site FRAXB, located at Xp22.3. Like other common fragile sites, it spans a large genomic region of approximately 500 kb. Three known genes, including the microsomal steroid sulfatase locus (STS), map within the fragile site region. We examined FRAXB and four other fragile sites (FRA3B, FRA7G, FRA7H, FRA16D), and several associated genes, for deletions and aberrant transcripts in a panel of cancer cell lines and primary tumors. Deletions within FRAXB were seen in 4/27 (14.8%) of the primary tumors and cell lines examined. Three of the 21 (14.3%) cell lines examined were characterized by loss of expression of one or more FRAXB‐associated genes. Moreover, all of the fragile sites examined were characterized by genomic deletions within the fragile site regions in one or more tumors or cell lines, including FRAXB, which is not associated with any known tumor suppressor genes or activity. Our results further support the hypothesis that common fragile sites and their associated genes are, in general, unstable in some cancer cells.

The canine copper toxicosis locus is not syntenic with ATP7B or ATX1 and maps to a region showing homology to human 2p21.

Canine copper toxicosis (CT) is an autosomal recessive disorder resulting in accumulation of copper at toxic levels in the liver owing to deficient excretion via the bile (Hardy et al. 1975). This disorder is prevalent in certain breeds, most notably the American and British Bedlington Terrier, where disease allele frequencies as high as 0.5 are present, resulting in phenotype frequencies of 25% affected and 50% carriers (Herrtage et al. 1987). Affected dogs develop excessive amounts of copper in their liver and, if untreated, will die of liver disease between 3 and 7 years of age. The gene responsible for canine CT is unknown, but candidates include ATP7B, the gene responsible for Wilson disease in humans (Bull et al. 1993; Tanzi et al. 1993), and the ATX1 (ATOX1 or HAH1) gene, which codes for a copper chaperone that delivers copper to ATP7B within liver cells (Klomp et al. 1997; Hung et al. 1998). Wilson disease in humans is similar to canine CT in that it is also an autosomal recessive disorder where copper accumulates in the liver owing to deficient copper excretion in the biliary system (Brewer and Yuzbasiyan-Gurkan 1992; Bull and Cox 1994). The protein product of ATP7B is a P-type ATPase which is expressed in the liver, kidney, and brain and functions to transport copper in the secretory pathway. Patients with Wilson disease accumulate excess copper primarily in their liver, and over time copper levels in the brain also increase, leading to a movement-type neurological disorder. Thus, the clinical phenotype is similar to canine CT, but differences exist. Neurological manifestations are not seen in canine CT, and affected Wilson disease patients have low levels of ceruloplasmin in their serum, while affected Bedlington terriers have normal levels of serum ceruloplasmin. In addition, the subcellular localization of copper accumulation in the liver differs between affected Wilson disease patients and affected Bedlington terriers. Wilson disease patients accumulate copper in their periportal hepatocytes, while affected Bedlington terriers accumulate copper in the center of the lobules (Owen and Ludwig 1982). HAH1 (ATOX1) (Klomp et al. 1997), the human ortholog of yeast Atx1p, is a cytoplasmic protein that functions as a copper chaperone and is thought to shuttle copper from the cell membrane to both ATP7B and ATP7A (Pufahl et al. 1997) localized in the trans Golgi complex (Dierick et al. 1997; Payne et al. 1998). While not as strong a candidate as the ATP7B gene, it is possible that a mutation in ATX1 could result in liver cirrhosis via interfering with the normal function of ATP7B without affecting the activity of ATP7A. No mammalian disorders have yet been attributed to a mutation in the ATX1 gene. Yuzbasiyan-Gurkan et al. (1997) performed linkage analysis with several Bedlington terrier pedigrees of the American Kennel Club to identify DNA microsatellite marker C04107 as being tightly linked to the CT locus with a LOD score of 5.96 at recombination fraction of zero. This polymorphic marker has been successfully applied in molecular diagnostic tests for CT in Bedlington terriers (Holmes et al. 1998; Ubbink et al. 1998). In an earlier study (Yuzbasiyan-Gurkan et al. 1993), the CT locus was found to be unlinked to the esterase D (ESD) and retinoblastoma (Rb1) loci, both of which show strong linkage to Wilson disease in humans. This suggested that the CT and ATP7B loci were different and unlinked in the dog, but data on linkage of the canine ATP7B, Rb1, and ESD loci is lacking and could differ from that seen in the human genome. In the present study, fluorescent in situ hybridization (FISH) was performed to determine whether candidate genes ATP7B or ATX1 mapped to the same or to different chromosomal locations from C04107. If either ATP7B or ATX1 mapped to the same chromosomal locus as C04107, it would suggest that CT may be a result of a mutation in that gene. If they mapped to different chromosomes, this would strongly support the hypothesis that another gene involved in mammalian copper transport or homeostasis is responsible for canine CT. A canine BAC library constructed from Doberman Pinscher DNA (Roswell Park Cancer Institute, RPCI, Buffalo, N.Y.) was screened with random primed (RediprimeTM II DNA Labeling System, Amersham Life Sciences, Arlington Heights, Ill.) P-labeled probes prepared from PCR products specific for the C04107, ATP7B, and ATX1 loci. PCR primers (forward-58 CCGGATCCTTTAGATGGGAC 38; reverse-58 CAGGTACCCAAGTCATTTGTCTATC 38) designed from sequence upstream of the cytosine-adenine (CA) repeat of microsatellite marker C04107 were used with dog spleen total genomic DNA as template in PCR reactions to generate the CT-specific probe. An ATP7B-specific probe was generated from a PCR reaction using primers (forward58 GACAAAACTGGCACCATACGCACG 38; reverse-58 GTTCTGGAGCTCCTGGACCTTGGCCAG 38) designed from canine exons 14 and 18 and a canine cDNA subclone, which contains ATP7B transmembrane domains 6–8, as template. HAH1 (ATX1) specific primers (forward-58 CAGTCATGCCGAAGCACGAG 38; reverse-58 CTGAGGGTCTCCGCAGGAAC 38) were used with human cDNA as template in a PCR reaction to generate a probe which was used in cross-species hybridization of the canine BAC filters. All PCR products used as probes were checked by sequencing with an Applied Biosystems model 373A automated sequencer. Positive BAC clones were purchased from RPCI and verified as having the correct loci by PCR and Southern blot analysis as well as sequencing. Canine BAC clones 27N21 and 225B1 contain the CA microsatellite C04107 as well as the upstream sequence used to generate the CT-specific probe. Minimally, exons 17 and 18 of the ATP7B gene are contained within BAC clone 243F13, while BAC clone 84B18 contains the ATX1 gene. To map the chromosomal location of these loci, BAC clones Correspondence to: S.L. Dagenais Mammalian Genome 10, 753–756 (1999).

FISH localization of the soluble thymidine kinase gene (TK1) to human 17q25, a region of chromosomal loss in sporadic breast tumors

Soluble thymidine kinase (TK1) is an important 17q marker in somatic cell genetics. Its activity is increased in many malignancies, including breast cancer. Through somatic cell hybrid and fluorescence in situ hybridization studies, we mapped TK1 to 17q25.2-->25.3, in region demonstrating loss of heterozygosity in primary breast tumors. It lies near D17S836 and is proximal to the avian erythroblastic leukemia viral oncogene homolog 2-like gene (ERBA2L).

Identification and mapping of a putative bombesin receptor gene on human chromosome 17q21.3

A mouse bombesin receptor cDNA was used as a probe to screen a human P1 genomic library. Clone HBR1 was isolated and used to localize a putative human bombesin receptor gene (HBRKS) on human chromosome 17q21.3 by fluorescent in situ hybridization (FISH). HBRKS was identified and mapped by polymerase chain reaction (PCR) amplification from a Yeast artificial chromosome (YAC) contig spanning 17q21-q23. In addition, a few candidate genes were found by exon-trapping from HBR1.