Dobrikov Mi

Photomodification of RNA and DNA fragments by oligonucleotide reagents bearing arylazide groups

Photomodification of ribo- and deoxyribo-octanucleotides by oligonucleotide reagents (6- and 7-mers) bearing p-azidotetrafluorobenzamido and 2-nitro-5-azidobenzamido groups has been investigated. It is shown that the oligonucleotides with a perfluoroarylazide group were effective modifiers both of deoxyribo- and ribo-targets. Maximum extent of cross-linked product formation (70%) was obtained when the deoxyribo-octanucleotide was modified by a heptanucleotide reagent with a perfluoroarylazide group. Selectivity of the photomodification was also high (50% on the G-residue at a certain position).

Sensitized photomodification of mammalian DNA polymerase β. A new approach for highly selective affinity labeling of polymerases

To enhance the specificity of polymerase photoaffinity labeling, a novel approach based on sensitized photomodification has been developed. A base‐substituted analog of TTP containing a pyrene group (PyrdUTP) was synthesized and used as an active site‐bound photosensitizer for photoaffinity modification of DNA polymerase β (pol β). 5′‐[32P]‐labeled primer was elongated in situ by pol β with a photoreactive analog of TTP (FAB‐4‐dUTP). The pyrene sensitizer (PyrdUTP), excited by light (365–450 nm), can activate the photoreagent, crosslinking it to pol β as a result of fluorescence resonance energy transfer. The initial rate of pol β photomodification was shown to increase by a factor of ten. The selectivity of pol β photosensitized modification was proved by adding human replication protein A.

Affinity modification of human immunodeficiency virus reverse transcriptase and DNA template by photoreactive dCTP analogs.

New base‐substituted analogs of dCTP containing an azido group have been synthesized and applied to a selective photoaffinity modification of HIV‐RT (p66/p51 heterodimer). The labeling of only the 66 kDa subunit of HIV‐RT was detected when the enzyme was first irradiated with the analogs and then template (5′‐(d)GGTTAAATAAAATAGTAAGAATGTATAGCCCCTACCA‐3′) and 5′ 32P end‐labeled 3′‐(d)TTACATATCGGGGATGGT‐5′primer were added. The 5′ 32P end‐labeled primer elongated by dCTP analogs in the presence of both HIV‐RT and DNA template is able to modify both subunits of HIV‐RT and DNA template. This way of specific cross‐linking to both DNA (RNA) template and HIV‐RT opens up new possibilities to study the HIV‐RT active site.

VISIBLE LIGHT ACTIVATABLE BINARY SYSTEM OF OLIGONUCLEOTIDE CONJUGATES FOR NUCLEIC ACIDS MODIFICATION

Abstract A binary system of oligonucleotides conjugated to perfluoroarylazide and perylene for sequence-specific photomodification of nucleic acids has been developed. The system can be activated by visible light (450-580 nm), reacts 300000 times faster than azide in the absence of perylene and provides highly efficient (up to 99%) photomodification of target ssDNA.

New Photoreactive mRNA Analogues for the Affinity Labeling of Ribosomes

Abstract Chemical synthesis of the model mRNA analogues (AUGU3, (pU)n) bearing p-azidotetrafluorobenzamido, p-azidobenzamido or 2-nitro-5-azidobenzamido groups coupled to the 5′-terminal phosphate or to the C-8-position of adenosine is described. The first results of the photoaffinity labeling study of human placenta ribosomes are presented.

Human immunodeficiency virus type 1 reverse transcriptase Affinity labeling of the primer binding site

Affinity modification of the primer site of HIV1‐RT was performed with an oligonucleotide derivative containing a photoreactive azido group at the 5′ end of d(pT)10. The affinity of HIV1‐RT for d(pT)10 and for its derivative was first estimated by measuring the Michaelis constants of these two oligonucleotides acting as primers in the retrotranscription of poly(rA). The enzyme was then inactivated under UV‐irradiation at 303–365 nm in the presence of ArN3‐d(U*T9); the dependence of the rate of inactivation on primer concentration was found to be consistent with the K m value. Last, selectivity of affinity modification was demonstrated through elongation of the covalently bound primer and selective protection of inactivation by d(pT)10 or tRNALy5.

Sensitized site-specific photomodification of ssDNA by binary systems of oligonucleotide conjugates: VI. Effect of substituents in the sensitizer anthracene residue

Photomodification of ssDNA by binary systems of oligonucleotide conjugates complementary to the adjacent sequences of the target DNA was studied. One of the conjugates comprised a substituted anthracene as a sensitizer; the other,p-azidotetrafluorobenzaldehyde 3-aminopropionylhydrazone as a photoreagent. The sensitized photomodification is initiated by the 365–580-nm light through an efficient energy transfer from the photoexcitated sensitizer onto the photoreagent in a complementary complex of the binary system with the DNA target where the sensitizer and the photoreagent are sterically converged. Influence of substituents in the anthracene residue on the efficiency of the DNA sensitized photomodification was considered. The oligonucleotide conjugate of anthracene-9-al 3-aminopropionylhydrazone allows highly specific initiation of the sensitized photomodification upon irradiation with visible light at >460 nm in conditions generating no photoreaction in the sensitizer’s absence.