Dona M. Chikaraishi

Analysis of neurogenesis in a mammalian neuroepithelium: Proliferation and differentiation of an olfactory neuron precursor in vitro

Development of a culture system for mammalian olfactory epithelium has permitted the process of neurogenesis to be examined in vitro. Antibody markers allowing the unambiguous identification of putative neuroepithelial stem cells (keratin+ basal cells) and differentiated neurons (N-CAM+ olfactory receptor neurons) are described. In combination with [3H]thymidine uptake analysis, these antibodies have been used to characterize the existence, proliferation, and differentiation of the immediate neuronal precursor in this system. This cell is distinct from basal cells and rapidly sorts out from them, dividing as it migrates. Data are presented which suggest that the precursor follows a simple lineage program, dividing to give rise to two N-CAM+ daughter neurons. Although this precursor efficiently generates neurons in defined medium, neurogenesis subsequently ceases because new precursors are not produced, suggesting that epigenetic factors may regulate continual neurogenesis in this system.

Catecholaminergic cell lines from the brain and adrenal glands of tyrosine hydroxylase-SV40 T antigen transgenic mice

Brain (CATH.a) and adrenal (PATH.1 and PATH.2) cell lines have been established that synthesize abundant dopamine and norepinephrine and express the appropriate catecholaminergic biosynthetic enzymes, tyrosine hydroxylase (TH) and dopamine beta-hydroxylase. The lines were derived from TH-positive tumors in transgenic mice carrying the SV40 T antigen oncogene under the transcriptional control of 773 base pairs of 5′ flanking sequences from the rat TH gene. Although the lines continue to express T antigen, they exhibit neuronal properties such as neurofilaments and synaptophysin and lack glial intermediate filaments. Although in vivo TH is only expressed in postmitotic neurons in the CNS, the CATH.a line demonstrates that TH expression and continued cell division are not incompatible after oncogenic transformation.

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.

Trans-synaptic increase in RNA coding for tyrosine hydroxylase in a rat sympathetic ganglion

To begin examining molecular mechanisms underlying trans-synaptic regulation, tyrosine hydroxylase (TH) and its messenger RNA (mRNA) were examined in the superior cervical sympathetic ganglion (SCG) of adult rats. Basal levels of TH mRNA were detectable in control ganglia by RNA dot hybridization, using the 32P nick translated PstI-KpnI restriction fragment of pTH.4 as a probe. Reserpine induced a 3-fold rise in TH activity per microgram protein, and a simultaneous 3-fold increase in ganglion TH mRNA. As expected, ganglion decentralization (denervation) prevented the trans-synaptic induction of TH. In addition, decentralization prevented the increase in TH mRNA, suggesting that the increase in message was dependent on trans-synaptic stimulation. Northern blot analysis indicated that the cDNA (complementary DNA) probe hybridized to a single band of approximately 1900 nucleotides, which was the same size in all ganglia. Our observations indicate that induction of TH is associated with a trans-synaptic increase in mRNA coding for the enzyme. Consequently, trans-synaptic increases in impulse activity may induce TH by increasing neuronal levels of TH mRNA in the SCG.

5′ Flanking DNA Sequences Direct Cell-Specific Expression of Rat Tyrosine Hydroxylase

Abstract: Tyrosine hydroxylase (TH) is selectively expressed in cat‐echolaminergic neurons and in chromaffin cells of the adrenal medulla. Constructs in which 5’flanking sequences of the rat TH gene directed expression of bacterial chloramphenicol acetyltransferase (CAT) were transfected into cell lines and assayed for transient expression of CAT. In most nonexpressing cell lines, CAT levels were < 5% of that found in a TH‐positive pheochromocytoma line (PC8b). In two lines described here, a rat anterior pituitary (pell line (GH4) and a rat fibroblast line (Fr3T3), CAT expression reached 12 and 20%, respectively, of the PC8b level. Greater than 90% of the PC8b activity was lost when sequences between ‐212 and ‐ 187 (in relation to the transcriptional initiation site) were deleted. Further deletions that removed the cyclic AMP response element (CRE)|(‐45) and the TATA box at ‐29 reduced transcriptional activity to background in all three lines. These data suggest that 212 nucleotides of the 5’sequence are sufficient for pheochromocytoma expression and that information between —212 and —187, which includes an API site (‐206 to —200), is essential for full transcriptional activity. In addition, sites for other protein transcription factors (AP2, POU/Oct, SP1, and CRE) reside between ‐221 and ‐38 and are largely conserved between the human and rat gene.

Catecholamine Synthesis is Mediated by Tyrosinase in the Absence of Tyrosine Hydroxylase

Catecholamine neurotransmitters are synthesized by hydroxylation of tyrosine to l-dihydroxyphenylalanine (l-Dopa) by tyrosine hydroxylase (TH). The elimination of TH in both pigmented and albino mice described here, like pigmented TH-null mice reported previously (Kobayashi et al., 1995; Zhou et al., 1995), demonstrates the unequivocal requirement for catecholamines during embryonic development. Although the lack of TH is fatal, TH-null embryos can be rescued by administration of catecholamine precursors to pregnant dams. Once born, TH-null pups can survive without further treatment until weaning. Given the relatively rapid half-life of catecholamines, we expected to find none in postnatal TH-null pups. Despite the fact that the TH-null pups lack TH and have not been supplemented with catecholamine precursers, catecholamines are readily detected in our pigmented line of TH-null mice by glyoxylic acid-induced histofluorescence at postnatal day 7 (P7) and P15 and quantitatively at P15 in sympathetically innervated peripheral organs, in sympathetic ganglia, in adrenal glands, and in brains. Between 2 and 22% of wild-type catecholamine concentrations are found in these tissues in mutant pigmented mice. To ascertain the source of the catecholamine, we examined postnatal TH-null albino mice that lack tyrosinase, another enzyme that converts tyrosine to l-Dopa but does so during melanin synthesis. In contrast to the pigmented TH-null mice, catecholamine histofluorescence is undetectable in postnatal albino mutants, and the catecholamine content of TH-null pups lacking tyrosinase is 18% or less than that of TH-null mice with tyrosinase. Thus, these extraordinary circumstances reveal that tyrosinase serves as an alternative pathway to supply catecholamines.

Early Fetal Hypoxia Leads to Growth Restriction and Myocardial Thinning

Hypoxia is necessary for fetal development; however, excess hypoxia is detrimental. Hypoxia has been extensively studied in the near-term fetus, but less is known about earlier fetal effects. The purpose of this study was to determine the window of vulnerability to severe hypoxia, what organ system(s) is most sensitive, and why hypoxic fetuses die. We induced hypoxia by reducing maternal-inspired O2 from 21% to 8%, which decreased fetal tissue oxygenation assessed by pimonidazole binding. The mouse fetus was most vulnerable in midgestation: 24 h of hypoxia killed 89% of embryonic day 13.5 (E13.5) fetuses, but only 5% of E11.5 and 51% of E17.5 fetuses. Sublethal hypoxia at E12.5 caused growth restriction, reducing fetal weight by 26% and protein by 45%. Hypoxia induced HIF-1 target genes, including vascular endothelial growth factor (Vegf), erythropoietin, glucose transporter-1 and insulin-like growth factor binding protein-1 (Igfbp-1), which has been implicated in human intrauterine growth restriction (IUGR). Hypoxia severely compromised the cardiovascular system. Signs of heart failure, including loss of yolk sac circulation, hemorrhage, and edema, were caused by 18-24 h of hypoxia. Hypoxia induced ventricular dilation and myocardial hypoplasia, decreasing ventricular tissue by 50% and proliferation by 21% in vivo and by 40% in isolated cultured hearts. Epicardial detachment was the first sign of hypoxic damage in the heart, although expression of epicardially derived mitogens, such as FGF2, FGF9, and Wnt9b was not reduced. We propose that hypoxia compromises the fetus through myocardial hypoplasia and reduced heart rate.

Elevation of RNA Coding for Tyrosine Hydroxylase in Rat Adrenal Gland by Reserpine Treatment and Exposure to Cold

Abstract: When rats are treated daily with reserpine or maintained at 4°C, the level of a specific RNA coding for tyrosine hydroxylase is elevated in the adrenal gland. The increase in this specific RNA temporally precedes and is quantitatively equal to the increase in adrenal tyrosine hydroxylase enzyme activity elicited by these treatments. These results suggest that prolonged stress may lead to changes in the levels of specific RNA species in the adrenal gland.

Tyrosine hydroxylase transcription depends primarily on cAMP response element activity, regardless of the type of inducing stimulus.

In neurons and neuroendocrine cells, tyrosine hydroxylase (TH) gene expression is induced by stimuli that elevate cAMP, by depolarization, and by hypoxia. Using these stimuli, we examined TH promoter mutants, cAMP response element binding protein (CREB) phosphorylation site mutants, and transcriptional interference with dominant negative transcription factors to assess the relative contributions of CREB/AP-1 family members to the regulation of basal and inducible TH transcription in PC12 cells. We found that basal transcription depends on transcription factor activity at the partial dyad (-17 bp), CRE (-45 bp), and AP1 (-205 bp) elements. Induced transcription is regulated primarily by activity at the CRE, with only small contributions from the AP1 or hypoxia response element 1 (HRE1; -225 bp) elements, regardless of inducing stimulus. CREB, ATF-1, and CREMtau all mediate CRE-dependent transcription, with CREB and CREMtau being more effective than ATF-1. Phosphorylation of CREB on Ser133, but not on Ser142 or Ser143, is required for induced transcription, regardless of inducing stimulus.

The Cyclic AMP Response Element Directs Tyrosine Hydroxylase Expression in Catecholaminergic Central and Peripheral Nervous System Cell Lines from Transgenic Mice

Enhancer elements regulating the neuronal gene, tyrosine hydroxylase (TH), were identified in TH-expressing peripheral nervous system PATH and central nervous system CATH cell lines. Mutational analysis in which rat TH 5′-flanking sequences directed chloramphenicol acetyltransferase (CAT) reporter gene expression demonstrated that mutating the cyclic AMP response element (CRE) at −45 base pair reduced expression by 80-90%. A CRE linked to an enhancerless TH promoter fully supported expression. Cotransfection of a dominant-negative CREB protein reduced expression 50-60%, suggesting that the CRE is bound by CREB or a CREB dimerization partner. Although mutating the AP1/dyad (AD) element at −205 base pair only modestly reduced CAT levels, AD minimal enhancer constructs gave 45-80% of wild type expression when positioned at −91 or −95. However, in its native context at −205, the AD could not support expression. In contrast, a CRE, moved from its normal position at −45 to −206, gave full activity. These results indicate that the CRE is critical for TH transcription in central nervous system CATH and peripheral nervous system PATH cells, whereas the AD is less important and its enhancer activity is context- and/or position-dependent. These results represent the first attempts to map regulatory elements directing TH expression in central nervous system cell lines.