Duane Shedd

Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50/Rta Protein Activates the Entire Viral Lytic Cycle in the HH-B2 Primary Effusion Lymphoma Cell Line

ABSTRACT Rta, the gene product of Kaposis sarcoma-associated herpesvirus (KSHV) encoded mainly in open reading frame 50 (ORF50), is capable of activating expression of viral lytic cycle genes. What was not demonstrated in previous studies was whether KSHV Rta was competent to initiate the entire viral lytic life cycle including lytic viral DNA replication, late-gene expression with appropriate kinetics, and virus release. In HH-B2, a newly established primary effusion lymphoma (PEL) cell line, KSHV ORF50 behaved as an immediate-early gene and autostimulated its own expression. Expression of late genes, ORF65, and K8.1 induced by KSHV Rta was eliminated by phosphonoacetic acid, an inhibitor of viral DNA polymerase. Transfection of KSHV Rta increased the production of encapsidated DNase-resistant viral DNA from HH-B2 cells. Thus, introduction of an ORF50 expression plasmid is sufficient to drive the lytic cycle to completion in cultured PEL cells.

Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements

ABSTRACT Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposis sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5′ AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5′ GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3′ end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

An Sp1 Response Element in the Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50 Promoter Mediates Lytic Cycle Induction by Butyrate

ABSTRACT Kaposis sarcoma-associated herpesvirus (KSHV) can be driven into the lytic cycle in vitro by phorbol esters and sodium butyrate. This report begins to analyze the process by which butyrate activates the promoter of KSHV open reading frame 50 (ORF50), the key viral regulator of the KSHV latency to lytic cycle switch. A short fragment of the promoter, 134 nucleotides upstream of the translational start of ORF50, retained basal uninduced activity and conferred maximal responsiveness to sodium butyrate. The butyrate response element was mapped to a consensus Sp1-binding site. By means of electrophoretic mobility shift assays, both Sp1 and Sp3 were shown to form complexes in vitro with the ORF50 promoter at the Sp1 site. Butyrate induced the formation of a group of novel complexes, including several Sp3-containing complexes, one Sp1-containing complex, and several other complexes that were not identified with antibodies to Sp1 or Sp3. Formation of all butyrate-induced DNA-protein complexes was mediated by the consensus Sp1 site. In insect and mammalian cell lines, Sp1 significantly activated the ORF50 promoter linked to luciferase. Chromatin immunoprecipitation experiments in a PEL cell line showed that butyrate induced Sp1, CBP, and p300 binding to the ORF50 promoter in vivo in an on-off manner. The results suggest that induction of the KSHV lytic cycle by butyrate is mediated through interactions at the Sp1/Sp3 site located 103 to 112 nucleotides upstream of the translational initiation of ORF50 presumably by enhancing the binding of Sp1 to this site.

Two Subclasses of Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycle Promoters Distinguished by Open Reading Frame 50 Mutant Proteins That Are Deficient in Binding to DNA

ABSTRACT A transcriptional activator encoded in open reading frame 50 (ORF50) of the Kaposis sarcoma-associated herpesvirus (KSHV) genome initiates the viral lytic cycle. Here we classify four lytic cycle genes on the basis of several characteristics of the ORF50 response elements (ORF50 REs) in their promoters: nucleotide sequence homology, the capacity to bind ORF50 protein in vitro, the ability to bind the cellular protein RBP-Jκ in vitro, and the capacity to confer activation by DNA binding-deficient mutants of ORF50 protein. ORF50 expressed in human cells binds the promoters of PAN and K12 but does not bind ORF57 or vMIP-1 promoters. Conversely, the RBP-Jκ protein binds ORF57 and vMIP-1 but not PAN or K12 promoters. DNA binding-deficient mutants of ORF50 protein differentiate these two subclasses of promoters in reporter assays; the PAN and K12 promoters cannot be activated, while the ORF57 and vMIP-1 promoters are responsive. Although DNA binding-deficient mutants of ORF50 protein are defective in activating direct targets, they are nonetheless capable of activating the lytic cascade of KSHV. Significantly, DNA binding-deficient ORF50 mutants are competent to autostimulate expression of endogenous ORF50 and to autoactivate ORF50 promoter reporters. The experiments show that ORF50 protein activates downstream targets by at least two distinct mechanisms: one involves direct binding of ORF50 REs in promoter DNA; the other mechanism employs interactions with the RBP-Jκ cellular protein bound to promoter DNA in the region of the ORF50 RE. The DNA binding-deficient mutants allow classification of ORF50-responsive genes and will facilitate study of the several distinct mechanisms of activation of KSHV lytic cycle genes that are under the control of ORF50 protein.

N-linked Glycosylation Is Required for Optimal Function of Kaposi's Sarcoma Herpesvirus-encoded, but Not Cellular, Interleukin 6

Kaposis sarcoma–associated herpesvirus interleukin-6 (vIL-6) is a structural and functional homologue of the human cytokine IL-6 (hIL-6). hIL-6 and vIL-6 exhibit similar biological functions and both act via the gp130 receptor subunit to activate the Janus tyrosine kinase (JAK)1 and signal transducer and activator of transcription (STAT)1/3 pathway. Here we show that vIL-6 is N-linked glycosylated at N78 and N89 and demonstrate that N-linked glycosylation at site N89 of vIL-6 markedly enhances binding to gp130, signaling through the JAK1-STAT1/3 pathway and functions in a cytokine-dependent cell proliferation bioassay. Although hIL-6 is also N-glycosylated at N73 and multiply O-glycosylated, neither N-linked nor O-linked glycosylation is necessary for IL-6 receptor α–dependent binding to gp130 or signaling through JAK1-STAT1/3. As distinct from vIL-6, unglycosylated hIL-6 is as potent as glycosylated hIL-6 in stimulating B cell proliferation. These findings highlight distinct functional roles of N-linked glycosylation in viral and cellular IL-6.

The Role of Complement in the Opsonization of Mucoid and Non-Mucoid Strains of Pseudomonas Aeruginosa

Summary: Requirements for complement and/or antibody for opsonization were assessed for 34 strains of Pseudomonas aeruginosa. Included were mucoid strains from patients with cystic fibrosis (CF), non-mucoid derivatives of these strains, and non-CF strains with classical morphology. Non-CF strains are known to vary as to opsonic requirements, but this study shows that mucoid strains are also diverse. Among the 14 mucoid strains, five could not be opsonized and completely resisted phagocytosis. All non-mucoid strains can be opsonized. When the bacteria were incubated in fresh human serum and stained with fluorescein, conjugated anti-C3 non-opsonizable strains did not bind C3 on the surface whereas five of six mucoid strains, which could be opsonized by complement alone, stained with anti-C3. In mucoid strains, surface characteristics correlate with differences in functional requirements for opsonization. In non-CF strains this specificity was not seen. Most mucoid strains required an intact classical complement pathway for opsonization. A number of mucoid strains could not be opsonized in the absence of a functional alternative complement pathway whereas in contrast, non-CF strains were not greatly affected by inactivation of the alternative pathway.

Stimulus Duration and Response Time Independently Influence the Kinetics of Lytic Cycle Reactivation of Epstein-Barr Virus

ABSTRACT Epstein-Barr virus (EBV) can be reactivated from latency into the lytic cycle by many stimuli believed to operate by different mechanisms. Cell lines containing EBV differ in their responses to inducing stimuli, yet all stimuli require de novo protein synthesis (44). A crucial step preliminary to identifying these proteins and determining when they are required is to measure the duration of stimulus and response time needed for activation of expression of EBV BRLF1 and BZLF1, the earliest viral indicators of reactivation. Here we show, with four EBV-containing cell lines that respond to different inducing agents, that stimuli that are effective at reactivating EBV can be divided into two main groups. The histone deacetylase inhibitors sodium butyrate and trichostatin A require a relatively long period of exposure, from 2 to 4 h or longer. Phorbol esters, anti-immunoglobulin G (anti-IgG), and, surprisingly, 5-aza-2′-deoxycytidine require short exposures of 15 min or less. The cell/virus background influences the response time. Expression of the EBV BZLF1 and BRLF1 genes can be detected before 2 h in Akata cells treated with anti-IgG, but both long- and short-duration stimuli required 4 or more hr to activate BZLF1 and BRLF1 expression in HH514-16, Raji, or B95-8 cells. Thus, stimulus duration and response time are independent variables. Neither stimulus duration nor response time can be predicted by the number of cells activated into the lytic cycle. These experiments shed new light on the earliest events leading to lytic cycle reactivation of EBV.

A Mobile Functional Region of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein Independently Regulates DNA Binding and Protein Abundance

ABSTRACT The protein encoded by open reading frame 50 (ORF50) of Kaposis sarcoma-associated herpesvirus (KSHV) functions as a transcriptional activator and in lytic viral DNA replication to mediate the switch from latent viral infection to the lytic phase. Here we identify regulatory regions of ORF50 protein that independently control DNA binding and abundance of the protein. One region contains a DNA-binding inhibitory sequence (DBIS) located between amino acids (aa) 490 and 535 of ORF50. A cluster of basic amino acids in this sequence is important in inhibiting DNA binding. The DBIS can function at the N or C terminus or internally in the ORF50 protein. Since the DBIS is functional in ORF50 protein purified from Escherichia coli, it is likely to work through an intramolecular mechanism. The second regulatory region, a protein abundance regulatory signal (PARS), consists of two components. Component I of the PARS overlaps the DBIS but can be differentiated from the DBIS by specific substitution of basic amino acid residues. Component II of PARS is located between aa 590 and 650. Mutation or deletion of either component results in abundant expression of ORF50 protein. When the two-component PARS was fused to a heterologous protein, Glutathione S-transferase, the fusion protein was unstable. Mutations in the DBIS or PARS impair the capacity of ORF50 to activate direct and indirect target viral promoters. Since these overlapping regulatory motifs are located in the C-terminal transactivation domain, they are likely to be important in controlling many actions of ORF50 protein.

Mutations of amino acids in the DNA-recognition domain of Epstein-Barr virus ZEBRA protein alter its sub-nuclear localization and affect formation of replication compartments

ZEBRA, a transcription factor and DNA replication protein encoded by the Epstein-Barr virus (EBV) BZLF1 gene, plays indispensable roles in the EBV lytic cycle. We recently described the phenotypes of 46 single amino acid substitutions introduced into the DNA-recognition region of ZEBRA [Heston, L., El-Guindy, A., Countryman, J., Dela Cruz, C., Delecluse, H.J., and Miller, G. 2006]. The 27 DNA-binding-proficient mutants exhibited distinct defects in their ability to activate expression of the kinetic classes of viral genes. Four phenotypic variants could be discerned: wild-type, defective at activating Rta, defective at activating early genes, and defective at activating late genes. Here we analyze the distribution of ZEBRA within the nucleus and the localization of EA-D (the viral DNA polymerase processivity factor), an indicator of the development of replication compartments, in representatives of each phenotypic group. Plasmids encoding wild-type (WT) and mutant ZEBRA were transfected into 293 cells containing EBV-bacmids. WT ZEBRA protein was diffusely and smoothly distributed throughout the nucleus, sparing nucleoli, and partially recruited to globular replication compartments. EA-D induced by WT ZEBRA was present diffusely in some cells and concentrated in globular replication compartments in other cells. The distribution of ZEBRA and EA-D proteins was identical to WT following transfection of K188R, a mutant with a conservative change. The distribution of S186A mutant ZEBRA protein, defective for activation of Rta and EA-D, was identical to WT, except that the mutant ZEBRA was never found in globular compartments. Co-expression of Rta with S186A mutant rescued diffuse EA-D but not globular replication compartments. The most striking observation was that several mutant ZEBRA proteins defective in activating EA-D (R179A, K181A and A185V) and defective in activating lytic viral DNA replication and late genes (Y180E and K188A) were localized to numerous punctate foci. The speckled appearance of R179A and Y180E was more regular and clearly defined in EBV-positive than in EBV-negative 293 cells. The Y180E late-mutant induced EA-D, but prevented EA-D from localizing to globular replication compartments. These results show that individual amino acids within the basic domain influence localization of the ZEBRA protein and its capacity to induce EA-D to become located in mature viral replication compartments. Furthermore, these mutant ZEBRA proteins delineate several stages in the processes of nuclear re-organization which accompany lytic EBV replication.

Efficient Induction of Nuclear Aggresomes by Specific Single Missense Mutations in the DNA-binding Domain of a Viral AP-1 Homolog

Nuclear aggresomes induced by proteins containing an expanded polyglutamine (polyQ) tract are pathologic hallmarks of certain neurodegenerative diseases. Some GFP fusion proteins lacking a polyQ tract may also induce nuclear aggresomes in cultured cells. Here we identify single missense mutations within the basic DNA recognition region of Bam HI Z E B virus replication activator (ZEBRA), an Epstein-Barr virus (EBV)-encoded basic zipper protein without a polyQ tract, that efficiently induced the formation of nuclear aggresomes. Wild-type (WT) ZEBRA was diffusely distributed within the nucleus. Four non-DNA-binding mutants, Z(R179E), Z(R183E), Z(R190E), and Z(K178D) localized to the periphery of large intranuclear spheres, to discrete nuclear aggregates, and to the cytoplasm. Other non-DNA-binding mutants, Z(N182K), Z(N182E), and Z(S186E), did not exhibit this phenotype. The interior of the spheres contained promyelocytic leukemia and HSP70 proteins. ZEBRA mutants directly induced the nuclear aggresome pathway in cells with and without EBV. Specific cellular proteins (SC35 and HDAC6) and viral proteins (WT ZEBRA, Rta, and BMLF1) but not other cellular or viral proteins were recruited to nuclear aggresomes. Co-transfection of WT ZEBRA with aggresome-inducing mutants Z(R183E) and Z(R179E) inhibited late lytic viral protein expression and lytic viral DNA amplification. This is the first reported instance in which nuclear aggresomes are induced by single missense mutations in a viral or cellular protein. We discuss conformational changes in the mutant viral AP-1 proteins that may lead to formation of nuclear aggresomes.