Elisa Leo

Cytoplasmatic compartmentalization by Bcr-Abl promotes TET2 loss-of-function in chronic myeloid leukemia.

The loss‐of‐function of ten–eleven‐translocation (TET) 2, a Fe2+‐oxoglutarate‐dependent dioxygenase catalyzing 5 methyl cytosine (5mC) conversion into 5‐hydroxymethylcytosine (5hmC), contributes to the hematopoietic transformation in vivo. The aim of our study was to elucidate its role in the phenotype of chronic myeloid leukemia (CML), a myeloproliferative disease caused by the Bcr‐Abl rearranged gene. We first confirmed TET2 interaction with the Bcr‐Abl protein predicted by a Fourier‐based bioinformatic method. Such interaction led to TET2 cytoplasmatic compartmentalization in a complex tethered by the fusion protein tyrosine kinase (TK) and encompassing the Forkhead box O3a (FoxO3a) transcription factor. We then focused the impact of TET2 loss‐of‐function on epigenetic transcriptional regulation of Bcl2‐interacting mediator (BIM), a pro‐apoptotic protein transcriptionally regulated by FoxO3a. BIM downregulation is a critical component of CML progenitor extended survival and is also involved in the disease resistance to imatinib (IM). Here we reported that TET2 release from Bcr‐Abl protein following TK inhibition in response to IM triggers a chain of events including TET2 nuclear translocation, re‐activation of its enzymatic function at 5mC and recruitment at the BIM promoter followed by BIM transcriptional induction. 5hmC increment following TET2 re‐activation was associated with the reduction of histone H3 tri‐methylation at lysine 9 (H3K9me3), which may contribute with DNA de‐methylation reported elsewhere to recast a permissive epigenetic “landscape” for FoxO3a transcriptional activity. J. Cell. Biochem. 113: 2765–2774, 2012.

Chibby drives β catenin cytoplasmic accumulation leading to activation of the unfolded protein response in BCR-ABL1+ cells.

Chronic myeloid leukemia (CML) is a myeloproliferative disease caused by the constitutive tyrosine kinase (TK) activity of the BCR-ABL fusion protein. However, the phenotype of leukemic stem cells (LSC) is sustained by β catenin rather than by the BCR-ABL TK. β catenin activity in CML is contingent upon its stabilization proceeding from the BCR-ABL-induced phosphorylation at critical residues for interaction with the Adenomatous polyposis coli (APC)/Axin/glycogen synthase kinase 3 (GSK3) destruction complex or GSK3 inactivating mutations. Here we studied the impact of β catenin antagonist Chibby (CBY) on β catenin signaling in BCR-ABL1+ cells. CBY is a small conserved protein which interacts with β catenin and impairs β catenin-mediated transcriptional activation through two distinct molecular mechanisms: 1) competition with T cell factor (TCF) or lymphoid enhancer factor (LEF) for β catenin binding; and 2) nuclear export of β catenin via interaction with 14-3-3. We found that its enforced expression in K562 cell line promoted β catenin cytoplasmic translocation resulting in inhibition of target gene transcription. Moreover, cytoplasmic accumulation of β catenin activated the endoplasmic reticulum (ER) stress-associated pathway known as unfolded protein response (UPR). CBY-driven cytoplasmic accumulation of β catenin is also a component of BCR-ABL1+ cell response to the TK inhibitor Imatinib (IM). It evoked the UPR activation leading to the induction of BCL2-interacting mediator of cell death (BIM) by UPR sensors. BIM, in turn, contributed to the execution phase of apoptosis in the activation of ER resident caspase 12 and mobilization of Ca(2+) stores.

DNA hypermethylation promotes the low expression of pro-apoptotic BCL2L11 associated with BCR-ABL1 fusion gene of chronic myeloid leukaemia

The authors declare no competing interests. Michelle A. Neller Andrew K. Sewell Scott R. Burrows John J. Miles Australian Centre for Vaccine Development, Human Immunity Laboratory and Cellular Immunology Laboratory, Queensland Institute of Medical Research Brisbane Queensland, Australia, T Cell Modulation Laboratory, Institute of Infection and Immunity Cardiff University School of Medicine Cardiff UK and School or Medicine, The University of Queensland Brisbane Queensland, Australia E-mail: john.miles@qimr.edu.au

A calpain-cleaved fragment of β-catenin promotes BCRABL1 + cell survival evoked by autophagy induction in response to imatinib

Autophagy protects chronic myeloid leukemia stem cells from tyrosine kinase inhibitors hence supporting the disease persistence under therapy. However, the signals involved in autophagy regulation relative to BCR-ABL1 are still elusive. The autophagic flux proceeding from the inhibition of BCR-ABL1 tyrosine kinase represents a regulatory mechanism of β-catenin stability through events encompassing the activation of calpain, which targets β-catenin for proteasome-independent degradation. Accordingly, its inactivation may contribute to induce autophagy and autophagy induction may, in turn, promote β-catenin autolysosomal degradation to originate a regulatory loop where β-catenin plays a central role in cell decision between life and death. Here we proved that the cytoplasmic accumulation of β-catenin driven by up-regulation of its antagonist Chibby1 is a component of autophagy induction in response to imatinib in BCR-ABL1+ cells opposing the apoptotic death. It is contingent upon ER stress and elevation of free Ca(2+) cytosolic concentration and results in the calpain cleavage into a 28kDa fragment implicated in β-catenin proteasome-independent degradation. More important for BCR-ABL1+ cell survival and proliferation following IM treatment, might be the calpain-mediated cleavage of β-catenin accumulated within the cytoplasmic compartment into a 75kDa fragment, still owning TCF-dependent transcriptional activity. Such a β-catenin fragment might be crucial for BCR-ABL1+ cell survival following the fusion protein TK inhibition.

BCR-ABL1-Associated Reduction of Beta Catenin Antagonist Chibby1 in Chronic Myeloid Leukemia

Beta Catenin signaling is critical for the self-renewal of leukemic stem cells in chronic myeloid leukemia. It is driven by multiple events, enhancing beta catenin stability and promoting its transcriptional co-activating function. We investigated the impact of BCR-ABL1 on Chibby1, a beta catenin antagonist involved in cell differentiation and transformation. Relative proximity of the Chibby1 encoding gene (C22orf2) on chromosome 22q12 to the BCR breakpoint (22q11) lets assume its involvement in beta catenin activation in chronic myeloid leukemia as a consequence of deletions of distal BCR sequences encompassing one C22orf2 allele. Forty patients with chronic myeloid leukemia in chronic phase were analyzed for C22orf2 relocation and Chibby1 expression. Fluorescent in situ hybridization analyses established that the entire C22orf2 follows BCR regardless of chromosomes involved in the translocation. In differentiated hematopoietic progenitors (bone marrow mononuclear cell fractions) of 30/40 patients, the expression of Chibby1 protein was reduced below 50% of the reference value (peripheral blood mononuclear cell fractions of healthy persons). In such cell context, Chibby1 protein reduction is not dependent on C22orf2 transcriptional downmodulation; however, it is strictly dependent upon BCR-ABL1 expression because it was not observed at the moment of major molecular response under tyrosine kinase inhibitor therapy. Moreover, it was not correlated with the disease prognosis or response to therapy. Most importantly, a remarkable Chibby1 reduction was apparent in a putative BCR-ABL1+ leukemic stem cell compartment identified by a CD34+ phenotype compared to more differentiated hematopoietic progenitors. In CD34+ cells, Chibby1 reduction arises from transcriptional events and is driven by C22orf2 promoter hypermethylation. These results advance low Chibby1 expression associated with BCR-ABL1 as a component of beta catenin signaling in leukemic stem cells.

Histone H3 covalent modifications driving response of BCR-ABL1+ cells sensitive and resistant to imatinib to Aurora kinase inhibitor MK-0457

The emergence of BCR-ABL1 point mutations leading to drug resistance is a major problem of imatinib (IM) treatment for chronic myeloid leukaemia (CML). Such mutations may be located either within or distant from the IM-binding site of the Abl domain, supporting that the destabilization of BCR-ABL1 inactive conformation (the only one inhibited by IM) is a central component of IM resistance. Due to their ability to inhibit mutated BCR-ABL1 kinase both in inactive and active conformation, Aurora kinase (AK) inhibitors have been adopted for the treatment of CML resistant to IM, including those associated with the most deleterious T315I mutation resistant to the second generation kinase inhibitors nilotinib and dasatinib (Young et al, 2006). However, mechanisms driving the response of BCR-ABL1+ haematopoiesis to AK inhibitors remain elusive. The present study showed that the AK inhibitor, MK-0457 (formerly referred to as VX-680), induces chromatin covalent modifications promoting the recruitment of transcriptional co-repressor heterochromatin protein (HP) 1 at a BCR promoter region critical for the fusion gene transcription. BCR-ABL1 downmodulation may concur to reduce the advantage of clonal haematopoiesis over its normal counterpart. This study used the K562 cell line, murine bone marrowderived Ba/F3 cells stably transduced with BCR-ABL1 constructs coding for either wild-type or T315I-mutated protein (kindly donated by M W Deininger, Division of Haematology and Haematologic Malignancies, University of Utah School of Medicine) and CD34 progenitors isolated from bone marrow samples of CML patients. Preliminary experiments confirmed MK-0457 in vitro cytotoxicity against all cell types tested due to a prominent arrest in the G2/M phase of cell cycle and induction of apoptotic death (data not shown). As expected, MK-0457 (100 nmol/l for 24 h) induced the dephosphorylation of p210 BCR-ABL1 protein at a Tyr residue (Y, located within the SH2-linker domain and proceeding from Tyr activating phosphorylation in the activation loop) and AK B at a Thr residue (T, located within the activation loop) in K562 cells (Fig 1A). Notably, neither drug significantly affected p210 BCR-ABL1 and AK B expression, confirming that protein clearance following their enzymatic activity inhibition required longer intervals (Fig 1A) (Brusa et al, 2006; Corrado et al, 2008). The reduction of BCR-ABL1 transcripts [quantified by a competitive polymerase chain reaction (PCR) strategy(Brusa et al, 2006)] in response to MK-0457 was similar to that elicited by 1 lmol/l IM, suggesting that the drug effects are concurrently driven by BCR-ABL1 kinase inhibition and BCRABL1 transcriptional down-modulation (Fig 1B) (Brusa et al, 2006). Combinatorial patterns of histone covalent modifications regulate DNA accessibility to the transcriptional apparatus. In particular, serine 10 at the N-terminal tail of histone H3 (H3S10) is a critical component of a ‘condensation code’ occurring during mitosis and has a key role in gene activation upon mitogen stimulation. Its phosphorylation (ph) is catalysed by AK B and disrupts the interactions of transcriptional repressor heterochromatin protein 1 (HP1) chromodomain with tri-methylated lysine 9 (H3K9me3) and acetylated lysine 14 (H3K14ac), the covalent modifications driving HP-1 delocalization from pericentromeric foci at the mitosis onset and from promoters of transiently silenced genes at the G0 to G1 transition (Crosio et al, 2002; Fischle et al, 2005). Densitometric analysis of signal intensities showed a significant reduction of H3S10ph associated with a significant increment of H3K9me3 (P < 0Æ001 in both cases) in K562 cells following AK B inhibition by MK-0457 (Fig 1A). The histone methyltransferase SUV39H1, whose function is restored by MK-0457induced inhibition of BCR-ABL1 kinase, probably contributes to the latter event (Brusa et al, 2006; Corrado et al, 2008). Indeed, SUV19H1 is a critical component of HP1 targeting to chromatin as it directly interacts with HP1 and stabilizes HP1 ligand to H3K9me3 (Stewart et al, 2005). PCR amplification (40 cycles of 0 s at 95 C, 0 s at 59 C and 25 s at 72 C) of DNA from chromatin immunoprecipitation (ChIP) products obtained with a ChIP grade anti-HP1 antibody (Upstate Biotechnology, Waltham, MA, USA) enabled assessment of the HP1 content at a minimal promoter region of BCR critical for BCR-ABL1 transcription [composed of 270 bp of 5¢ flanking sequence and 380 bp of exon 1 transcribed sequence and amplified by 5¢ CTGCGAGTTCTGCCAGAGAG 3¢ (upper primer) and 5¢ CACCCTCCCCCCGTCCCTGT 3¢ (lower primer)]. Densitometric analysis of BCR promoter amplification signals relative to the constitutively acetylated promoter of human histone H4a (region )40 to +285) showed significantly greater HP1 recruitment at the BCR promoter by MK-0457 compared to IM (P < 0Æ0001 vs. P < 0Æ001) (Fig 1C). These findings suggest that BCR-ABL1 transcript reduction is driven by BCR-ABL1 kinase inhibition through additional post-translational events (including the de-acetylation of histone H4) which may interfere with RNA polymerase processivity and correspondence

14-3-3 Binding and Sumoylation Concur to the Down-Modulation of β-catenin Antagonist chibby 1 in Chronic Myeloid Leukemia

The down-modulation of the β-catenin antagonist Chibby 1 (CBY1) associated with the BCR-ABL1 fusion gene of chronic myeloid leukemia (CML) contributes to the aberrant activation of β-catenin, particularly in leukemic stem cells (LSC) resistant to tyrosine kinase (TK) inhibitors. It is, at least partly, driven by transcriptional events and gene promoter hyper-methylation. Here we demonstrate that it also arises from reduced protein stability upon binding to 14-3-3σ adapter protein. CBY1/14-3-3σ interaction in BCR-ABL1+ cells is mediated by the fusion protein TK and AKT phosphorylation of CBY1 at critical serine 20, and encompasses the 14-3-3σ binding modes I and II involved in the binding with client proteins. Moreover, it is impaired by c-Jun N-terminal kinase (JNK) phosphorylation of 14-3-3σ at serine 186, which promotes dissociation of client proteins. The ubiquitin proteasome system UPS participates in reducing stability of CBY1 bound with 14-3-3σ through enhanced SUMOylation. Our results open new routes towards the research on molecular pathways promoting the proliferative advantage of leukemic hematopoiesis over the normal counterpart.

DNA methyltransferase 1 drives transcriptional down-modulation of β catenin antagonist Chibby1 associated with the BCR-ABL1 gene of chronic myeloid leukemia.

The decrease of Chibby1 (CBY1) contributes to β catenin constitutive activation associated with the presence of the BCR‐ABL1 fusion gene of chronic myeloid leukemia (CML). This is mediated by transcriptional events and driven by DNA hyper‐methylation at promoter‐associated CpG islands of the CBY1‐encoding gene C22orf2. Moreover, CBY1 transcriptional induction proceeding from promoter de‐methylation is a component of BCR‐ABL1+ cell response to Imatinib (IM). Our study showed that DNA methyltransferase 1 (DNMT1) has a central role in the hyper‐methylation at the C22orf2 promoter. Further investigation in leukemic hematopoietic progenitors from IM‐responsive and IM‐resistant CML patients at diagnosis failed to demonstrate any correlation between DNMT1‐driven hyper‐methylation of the C22orf2 promoter and response to IM. Notably, the response to IM was neither predicted by DNMT1‐driven hyper‐methylation of BCL2‐like11 at diagnosis. In conclusion, the hypermethylation of C22orf2 and BCL2‐like11 promoters proceeding from DNMT1 is a crucial component of their reduced expression, but it is not directly involved in CML resistance to IM. It might rather contribute to the disease evolution towards a drug‐resistant phenotype in more advanced phases or blast crisis. J. Cell. Biochem. 116: 589–597, 2015.

FOXM1 Transcription Factor: A New Component of Chronic Myeloid Leukemia Stem Cell Proliferation Advantage

FOXM1 transcription factor is a central component of tumor initiation, growth, and progression due to its multiple effects on cell cycle, DNA repair, angiogenesis and invasion, chromatin, protein anabolism, and cell adhesion. Moreover, FOXM1 interacts with β‐catenin promoting its nuclear import and transcriptional activation. Here, we show that FOXM1 is involved in the advantage of chronic myeloid leukemia hematopoiesis over the normal counterpart. FOXM1 hyper‐activation associated with BCR‐ABL1 results from phosphorylation by the fusion protein kinase‐dependent activation of Polo‐like kinase 1. FOXM1 phosphorylation lets its binding with β‐catenin and β‐catenin transcriptional activation, a key event for persistence of the leukemic stem cell compartment under tyrosine kinase inhibitor therapy. Polo‐like kinase 1 inhibitor BI6727, already advanced for clinical use, breaks β‐catenin interaction with FOXM1, hence hampering FOXM1 phosphorylation, β‐catenin binding, nuclear import, and downstream signaling. In conclusion, our results support Polo‐like kinase 1/FOXM1 axis as a complementary target to eradicate leukemic early progenitor/stem cell compartment in chronic myeloid leukemia. J. Cell. Biochem. 118: 3968–3975, 2017.

DNA Methylation in Chronic Myeloid Leukemia

Despite the high efficiency of tyrosine kinase inhibitors in the treatment of chronic myeloid leukemia, 20-25% of patients develop drug resistance resulting in therapy failure. Besides mutations of the BCR-ABL1 kinase domain, the abnormal epigenetic regulation of the expression of critical genes for cell proliferation and survival has a central role in the disease pathogenesis and progression towards the drug resistant phenotype. Such epigenetic changes have the potential to be modulated by specific drugs including demethylating agents and histone deacetylase inhibitors. Here the current knowledge on the BCR-ABL1-associated methylation status is reviewed.