Elisabeth A. Owen

Structure of the theta subunit of Escherichia coli DNA polymerase III in complex with the epsilon subunit.

The catalytic core of Escherichia coli DNA polymerase III contains three tightly associated subunits, the alpha, epsilon, and theta subunits. The theta subunit is the smallest and least understood subunit. The three-dimensional structure of theta in a complex with the unlabeled N-terminal domain of the epsilon subunit, epsilon186, was determined by multidimensional nuclear magnetic resonance spectroscopy. The structure was refined using pseudocontact shifts that resulted from inserting a lanthanide ion (Dy3+, Er3+, or Ho3+) at the active site of epsilon186. The structure determination revealed a three-helix bundle fold that is similar to the solution structures of theta in a methanol-water buffer and of the bacteriophage P1 homolog, HOT, in aqueous buffer. Conserved nuclear Overhauser enhancement (NOE) patterns obtained for free and complexed theta show that most of the structure changes little upon complex formation. Discrepancies with respect to a previously published structure of free theta (Keniry et al., Protein Sci. 9:721-733, 2000) were attributed to errors in the latter structure. The present structure satisfies the pseudocontact shifts better than either the structure of theta in methanol-water buffer or the structure of HOT. satisfies these shifts. The epitope of epsilon186 on theta was mapped by NOE difference spectroscopy and was found to involve helix 1 and the C-terminal part of helix 3. The pseudocontact shifts indicated that the helices of theta are located about 15 A or farther from the lanthanide ion in the active site of epsilon186, in agreement with the extensive biochemical data for the theta-epsilon system.

The three-dimensional structure of the 4:1 mithramycin:d(ACCCGGGT)2 complex: evidence for an interaction between the E saccharides

Mithramycin and chromomycin, two antitumor drugs, each having an identical aglycone and nearly identical disaccharide and trisaccharide side chains, have differing binding properties to a small oligonucleotide, d(ACCCGGGT)(2) (M. A. Keniry et al., Journal of Molecular Biology, 1993, Vol. 231, pp. 753-767). In order to understand the forces that induce four mithramycin molecules to bind to d(ACCCGGGT)(2) instead of two drug molecules in the case of chromomycin, the structure of the 4:2:1 mithramycin: Mg(2+):d(ACCCGGGT)(2) complex was investigated by (1)H-nmr and restrained molecular dynamics. The resulting three-dimensional model showed that in order to accommodate the close approach of one neighboring mithramycin dimer, the inwardly directed CDE saccharide chain of the neighboring mithramycin dimer undergoes a conformational change such that the E saccharide no longer spans the minor groove but reorients so that the hydrophilic face of the E saccharides from the two dimers oppose each other. Two hydrogen bonds are formed between the hydroxyl groups of the two opposing E saccharide groups. The results are interpreted in terms of the differences in stereochemistry and functional group substitutions between mithramycin and chromomycin. A mithramycin dimer is able to self-associate on an oligonucleotide template because it has two hydroxyl groups on the same face of its terminal E saccharide. A chromomycin dimer is unable to self-associate because one of these hydroxyl groups is acetylated and the neighboring hydroxyl group has a stereochemistry that cannot permit close contact of the hydroxyl group with a neighbouring chromomycin dimer.

Effect of thermodynamic nonideality in kinetic studies: Evidence for reversible unfolding of urease during urea hydrolysis

A combination of enzyme kinetic studies and active enzyme gel chromatography on Sepharose CL-6B was used to explore conformational changes of the enzyme urease as it catalyzes the hydrolysis of urea in 0.7 M phosphate buffer, pH 7.0, at 20 degrees C. It is shown that elucidation of this system is only possible by studying the effects of inert space-filling macromolecules (ovalbumin and bovine serum albumin) on enzymatic behavior. The resulting increases in reaction velocity are interpreted in terms of composition-dependent activity coefficients assessed on a statistical mechanical basis of excluded volume. The results are first considered in terms of two extreme models; one involving a volume change on the isomerization of the enzyme-substrate complex to its activated state, and the other an isomeric expansion of the enzyme-substrate complex to an inactive form. Although both extreme models provide satisfactory descriptions of the kinetic results, they lead to unrealistic values for the radii of the various states of the enzyme-substrate complex. It is concluded, therefore, that the two isomeric transitions act conjointly, a result in conformity with the previously postulated conformational change associated with formation of the activated enzyme-substrate complex [L. W. Nichol, M. J. Sculley, L. D. Ward, and D. J. Winzor (1983) Arch. Biochem. Biophys. 222, 574-581], and also with the well-established action of the substrate, urea, as an unfolding agent of proteins.

Physicochemical characterization of high-molecular-weight α-crystallin subpopulations from the calf lens nucleus

Calf lens nuclear alpha-crystallin was separated into five molecular weight subpopulations by exclusion chromatography on Bio-Gel A-5m. These subpopulations were compared by amino acid analysis, ultraviolet absorption analysis, fluorescence, far- and near-ultraviolet circular dichroism, isoelectric focusing, SDS-polyacrylamide gel electrophoresis and sedimentation velocity analysis. Although only minor differences were detectable in most physicochemical properties, progressive changes were found in the near-ultraviolet circular dichroism spectra and in pellet hardness after centrifugation. Minute amounts of beta-crystallin polypeptides and a 43 kDa component were present in all five subpopulations. In addition, the highest molecular weight aggregates contain some gamma-crystallin polypeptides. A slow re-equilibration of separated subpopulations towards the initial distribution was observed by rechromatography.

Insight into the molecular recognition of spermine by DNA quadruplexes from an NMR study of the association of spermine with the thrombin-binding aptamer

The preferred residence sites and the conformation of DNA‐bound polyamines are central to understanding the regulatory roles of polyamines. To this end, we have used a series of selective 13C‐edited and selective total correlation spectroscopy‐edited one‐dimensional (1D) nuclear Overhauser effect spectroscopy NMR experiments to determine a number of intramolecular 1H nuclear Overhauser effect (NOE) connectivities in 13C‐labelled spermine bound to the thrombin‐binding aptamer. The results provide evidence that the aptamer‐bound spermine adopts a conformation that optimizes electrostatic and hydrogen bond contacts with the aptamer backbone. The distance between the nitrogen atoms of the central aminobutyl is reduced by an increase in the population of gauche conformers at the C6–C7 bonds, which results in either a curved or S‐shaped spermine conformation. Molecular modelling contributes insight toward the mode of spermine binding of these spermine structures within the narrow grooves of DNA quadruplexes. In each case, the N5 ammonium group makes hydrogen bonds with two nearby phosphates across the narrow groove. Our results have implications for the understanding of chromatin structure and the rational design of quadruplex‐binding drugs. Copyright

Structural homology of lens crystallins. II. Homology expressed by correlation coefficients and hydropathy profiles.

Bovine lens alpha A- and alpha B-crystallin polypeptides show extensive sequence homology with each other, but apparently none with beta Bp- and gamma 2-crystallin. Despite only 30% sequence homology, the latter two proteins are assumed to have a strong correspondence in tertiary structure, consisting of four structurally similar folding units of antiparallel beta-sheet. We have tested for internal structural repeats in all crystallins, and structural homology between crystallins, by comparing various physical properties of the amino acid residues, such as bulkiness and propensity to form beta-sheet and beta-turn structure. Two procedures used a combination of five physical parameters to calculate correlation coefficients. The 4-fold structural repeat in gamma 2-crystallin and the internal duplication in beta Bp-crystallin were readily detectable, as was also the strong structural homology between corresponding folding units in beta Bp- and gamma 2-crystallin. However, for alpha-crystallin polypeptides, no conclusive support was obtained for either a four-unit or a six-unit folding, the two models previously considered by us. The third procedure compared smoothened hydropathy plots, representing hydrophilic and hydrophobic regions along the polypeptide sequences. Hydropathy profiles were found to show strong correspondence, particularly between alpha B-crystallin and beta Bp-crystallin. These observations support a similar 4-fold folding pattern for all bovine crystallins. A possible role in subunit interactions of the N-terminal folding unit, which has hydrophobic surface characteristics in both alpha- and beta-crystallin polypeptides, is proposed.

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

The flanking sequence contributes to the immobilisation of spermine at the G-quadruplex in the NHE (nuclease hypersensitivity element) III1 of the c-Myc promoter

Defining the molecular basis of the DNA sequence selectivity of polyamine binding is central to understanding polyamine‐dependent gene expression. We have studied, by selective NMR experiments, the variation of spermine mobility and conformation in the presence of G‐quadruplexes formed by sequences of the purine‐rich strand of the c‐Myc promoter, nuclease hypersensitivity element III1 (NHE III1). All the NHE quadruplexes restrict spermine mobility and induce a spermine conformational change but the most effective immobilisation occurs when all five G‐tracts of the NHE III1 are present. This suggests structure within the nucleotides flanking the G‐quadruplex has a role in immobilising spermine.

A macromolecular shape function based on sedimentation velocity parameters

A volume-independent shape function, experimentally determinable from sedimentation velocity experiments, was formulated explicitly in terms of the axial ratio of a macromolecule considered as an ellipsoid of revolution. Use of this function offers a simple first approach to the elucidation of macromolecular geometry as illustrated by calculations for ovalbumin, bovine serum albumin, and myosin.