Elizabeth Baker

Mapping of DNA instability at the fragile X to a trinucleotide repeat sequence p(CCG)n

The sequence of a Pst I restriction fragment was determined that demonstrate instability in fragile X syndrome pedigrees. The region of instability was localized to a trinucleotide repeat p(CCG)n. The sequence flanking this repeat were identical in normal and affected individuals. The breakpoints in two somatic cell hybrids constructed to break at the fragile site also mapped to this repeat sequence. The repeat exhibits instability both when cloned in a nonhomologous host and after amplification by the polymerase chain reaction. These results suggest variation in the trinucleotide repeat copy number as the molecular basis for the instability and possibly the fragile site. This would account for the observed properties of this region in vivo and in vitro.

Fragile X genotype characterized by an unstable region of DNA

DNA sequences have been located at the fragile X site by in situ hybridization and by the mapping of breakpoints in two somatic cell hybrids that were constructed to break at the fragile site. These hybrids were found to have breakpoints in a common 5-kilobase Eco RI restriction fragment. When this fragment was used as a probe on the chromosomal DNA of normal and fragile X genotype individuals, alterations in the mobility of the sequences detected by the probe were found only in fragile X genotype DNA. These sequences were of an increased size in all fragile X individuals and varied within families, indicating that the region was unstable. This probe provides a means with which to analyze fragile X pedigrees and is a diagnostic reagent for the fragile X genotype.

CD30 antigen, a marker for Hodgkin's lymphoma, is a receptor whose ligand defines an emerging family of cytokines with homology to TNF

CD30 is a surface marker for neoplastic cells of Hodgkins lymphoma and shows sequence homology to members of the tumor necrosis factor (TNF) receptor superfamily. Using a chimeric probe consisting of the extracellular domain of CD30 fused to truncated immunoglobulin heavy chains, we expression cloned the cDNA cognate from the murine T cell clone 7B9. The encoded protein is a 239 amino acid type II membrane protein whose C-terminal domain shows significant homology to TNF alpha, TNF beta, and the CD40L. Cross-hybridization to an induced peripheral blood T cell cDNA library yielded the human homolog, which is 72% identical at the amino acid level. The recombinant human ligand enhances the proliferation of CD3-activated T cells yet induces differential responses, including cell death, in several CD30+ lymphoma-derived clones. The human and murine genes map to 9q33 and the proximal region of chromosome 4, respectively.

Molecular and biological characterization of a ligand for CD27 defines a new family of cytokines with homology to tumor necrosis factor

CD27 is a surface antigen found on T and B cells that has homology to a family of molecules including the receptors for tumor necrosis factor (TNF) and nerve growth factor. A cDNA encoding a ligand for CD27 was isolated by a direct-expression cloning strategy using a fusion protein composed of the extracellular domain of CD27 linked to the constant domain of a human immunoglobulin G1 molecule as a probe. The predicted protein product is a type II transmembrane protein whose gene maps to 19p13 and that shows homology to TNF and the ligand for CD40. Biological characterization indicates that the cloned ligand induces the proliferation of costimulated T cells and enhances the generation of cytolytic T cells.

Human Chromosomal Fragile Site FRA16B Is an Amplified AT-Rich Minisatellite Repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Fragile sites still breaking.

Rare fragile sites on chromosomes are the archetypal dynamic mutations. They involve large expansions of the microsatellite CCG or AT-rich minisatellites. The mutation process is an increase in repeat-unit number from within a normal range, through a premutation range, up to full mutation where the fragile site is expressed. Full mutations can inactivate genes and are regions of genomic instability. Common fragile sites, in particular, might have a role in oncogensis by facilitating gene inactivation through chromosomal deletion or amplification, but this requires further exploration. The mechanisms behind the changes that give rise to the cytogenetic manifestation of chromosomal fragility are now beginning to be understood.

Localization of the human multiple drug resistance gene, MDR1, to 7q21.1

SummaryMultiple drug resistance has been shown to be associated with amplification/increased expression of a gene designated MDR. The localization of one member of the MDR gene family, MDR1, to the long arm of chromosome 7 by in situ hybridization is reported.

New classes of common fragile sites induced by 5-azacytidine and bromodeoxyuridine

SummaryTwo new classes of common fragile site seen in chromosomes from blood lymphocyte cultures are reproted. The first cláss is induced in bands 1q42 and 19q13 by 5-azacytidine (5-AZA). Maximum induction of these fragile sites occurs when the 5-AZA is added 5–8 h prior to harvest. The second class is induced in bands 6q13, 9p21, and 10q21 by bromodeoxyuridine (BrdU). In this instance maximum induction occurred if the BrdU was added 4–6h prior to harvest. The known fragile sites, both rare and common, are summarised.

Molecular characterization, pharmacological properties and chromosomal localization of the human GALR2 galanin receptor

The neuropeptide galanin mediates a diverse spectrum of biological activities by interacting with specific G protein-coupled receptors. We have used homology genomic library screening and polymerase chain reaction (PCR) techniques to isolate both genomic and cDNA clones encoding the human homolog of the recently cloned rat GALR2 galanin receptor. By fluorescence in situ hybridization, the gene encoding human GALR2 (GALNR2) has been localized to chromosome 17q25.3. The two coding exons of the human GALNR2 gene, interrupted by an intron positioned at the end of transmembrane domain III, encode a 387 amino acid G protein-coupled receptor with 87% overall amino acid identity with rat GALR2. In HEK-293 cells stably expressing human GALR2, binding of [125I]porcine galanin is saturable and can be displaced by galanin, amino-terminal galanin fragments and chimeric galanin peptides but not by carboxy-terminal galanin fragments. In HEK-293 cells, human GALR2 couples both to Galphaq/11 to stimulate phospholipase C and increase intracellular calcium levels and to Galphai/o to inhibit forskolin-stimulated intracellular cAMP accumulation. A wide tissue distribution is observed by reverse transcriptase (RT)-PCR analysis, with human GALR2 mRNA being detected in many areas of the human central nervous system as well as in peripheral tissues.

FRA10B Structure Reveals Common Elements in Repeat Expansion and Chromosomal Fragile Site Genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.