Emel Canbay

Gastric Necrosis and Perforation Caused by Acute Gastric Dilatation : Report of a Case

Abstract.We report the case of an 18-year-old, mentally retarded boy who suffered acute abdominal symptoms and signs after eating a heavy meal. Laparotomy showed massive gastric dilatation with near-total infarction and perforation. Total gastrectomy and esophagojejunostomy were performed, but the patient died a few hours after the operation.

Association of APE1 and hOGG1 polymorphisms with colorectal cancer risk in a Turkish population

Abstract Background: There is growing evidence describing DNA repair genes polymorphisms are related to increased cancer risk including colorectal cancer (CRC). The aim of this study was to investigate the associations between the APE1 Asp148Glu, hOGG1 Ser326Cys, XRCC1 Arg399Gln, XRCC3 Thr241Met, XPD Lys751Gln, XPG Asp1104His polymorphisms and CRC risk in Turkish population. Patients and methods: Polymorphisms of APE1 Asp148Glu (rs3136820), hOGG1 Ser326Cys (rs1052133), XRCC1 Arg399Gln(rs25487), XRCC3 Thr241Met (rs861539), XPD Lys751Gln (rs13181), and XPG Asp1104His (rs17655) were determined by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) methods in blood samples of 79 CRC patients at their initial staging and 247 healthy controls. Of the CRC patients, 26 out of 40 were diagnosed with rectal cancer and received neoadjuvant chemoradiotherapy following diagnosis; 39 others were diagnosed as colon cancer. Results: Our preliminary results showed that frequencies of Glu allele of APE1 Asp148Glu and Cys allele of hOGG1 Ser326Cys were higher in CRC patients than in controls (p = 0.006, OR: 3.43; 95% CI: 1.76–6.70; p = 0.000, OR: 2.77; 95% CI: 1.40–5.48, respectively). Higher frequency of Met allele of XRCC3 Thr241Met was detected in patients treated with neoadjuvant chemoradiotherapy (p = 0.024, OR: 5.25; 95% CI: 1.23–23.39) and with proximal colon tumors (p = 0.04, OR: 2; 95% CI: 1.18–3.34). Increased frequency of Ser/Ser genotype of hOGG1 Ser326Cys was found to be associated both with higher grade (p = 0.001, OR: 6.4; 95% CI: 2.69–62.69) and liver metastasis (p = 0.005, OR: 7.5; 95% CI: 0.7–68.36). Conclusion: APE1 Asp148Glu and hOGG1 Ser326Cys polymorphisms might be associated with increasing risk of CRC in a Turkish population. Future studies with larger-sized samples, as well as detecting the association of DNA repair genes with other confounding factors will help elucidate the exact roles of DNA repair genes polymorphisms in development and progression of CRC.

Chlorhexidine Gluconate: An Ideal Scolicidal Agent in the Treatment of Intraperitoneal Hydatidosis?

Hydatid disease is a parasitic disease that is treated primarily by surgery. The most important complication of surgical treatment is spillage of the contents of the cyst, leading to secondary dissemination. In this study, the effect of chlorhexidine gluconate (Chx-Glu) was investigated in the treatment of experimental intraperitoneal hydatidosis (IPH). IPH was reproduced in 100 Wistar albino rats by inoculation with 1 ml of a suspension contained approximately 1500 viable protoscolices of Echinococcus granulosus following determination of scolicidal activity of chlorhexidine gluconate in vitro. Five minutes after protoscolex inoculation, 5 ml of the scolicidal solution was instilled into the peritoneal cavity: 0.9% NaCl (control group), 4.0% Chx-Glu, 0.4% Chx-Glu, and 0.04% Chx-Glu. After 6 months of follow-up, the rats were sacrificed, and the number of isolated cysts, peroperative and postoperative deaths, and toxicity were evaluated. Cyst formation did not occur in any of the Chx-Glu groups compared to the control group (p < 0.05), whereas it was detected in all of the control rats. In addition, to 4.0% Chx-Glu was found to be more toxic and to cause a high mortality rate compared to the 0.4% and 0.04% Chx-Glu groups and the control group (p < 0.05). Chx-Glu 0.04% was found to be the most potent, nontoxic agent; it is easily available, inexpensive, and highly potent in a short period of time at the low concentration. Chx-Glu 0.04% can be used safely in the treatment of intraperitoneal hydatidosis and hydatid cyst.

Axillary sentinel node biopsy after neoadjuvant chemotherapy

INTRODUCTION The role of sentinel lymph node biopsy (SLNB) in patients with locally advanced breast cancer (LABC) with potentially sterilized axillary lymph nodes after neoadjuvant chemotherapy (NAC) remains unclear. PATIENTS AND METHODS Between 2002 and 2008, SLNB with both blue-dye and radioisotope injection was performed in 77 patients with LABC whose cytopathologically confirmed positive axillary node(s) became clinically negative after NAC. Factors associated with SLN identification and false-negative rates, presence of non-sentinel lymph node (non-SLN) metastasis were analyzed retrospectively. RESULTS SLNB was successful in 92% of the patients. Axillary status was predicted with 90% accuracy and a false-negative rate of 13.7%. Patients with residual tumor size >2 cm had a decreased SLN identification rate (p=0.002). Axillary nodal status before NAC (N2 versus N1) was associated with higher false-negative rates (p=0.04). Positive non-SLN(s) were more frequent in patients with multifocal/multicentric tumors (versus unifocal; p=0.003) and positive lymphovascular invasion (versus negative; p=0.0001). SLN(s) positive patients with pathologic tumor size >2 cm (versus <or=2 cm; p=0.004), positive extra-sentinel lymph node extension (versus negative; p=0.002) were more likely to have metastatic non-SLN(s). CONCLUSIONS SLNB has a high identification rate and modest false-negative rate in LABC patients who became clinically axillary node negative after NAC. Residual tumor size and nodal status before NAC affect SLNB accuracy. Additional involvement of non-SLN(s) increases with the presence of multifocal/multicentric tumors, lymphovascular invasion, residual tumor size >2 cm, and extra-sentinel node extension.

Prognostic Factors of Peritoneal Metastases from Colorectal Cancer following Cytoreductive Surgery and Perioperative Chemotherapy

Background. Prolonged survival of patients affected by peritoneal metastasis (PM) of colorectal origin treated with complete cytoreduction followed by intraoperative hyperthermic intraperitoneal chemotherapy (HIPEC) has been reported. However, two-thirds of the patients after complete cytoreduction and perioperative chemotherapy (POC) develop recurrence. This study is to analyze the prognostic factors of PM from colorectal cancer following the treatment with cytoreductive surgery (CRS) + POC. Patients and Methods. During the last 8 years, 142 patients with PM of colorectal origin have been treated with CRS and perioperative chemotherapy. The surgical resections consisted of a combination of peritonectomy procedures. Results. Complete cytoreduction (CCR-0) was achieved at a higher rate in patients with peritoneal cancer index (PCI) score less than 10 (94.7%, 71/75) than those of PCI score above 11 (40.2%, 37/67). Regarding the PCI of small bowel (SB-PCI), 89 of 94 (91.5%) patients with ≤2 and 22 of 48 (45.8%) patients with SB-PCI ≥ 3 received CCR-0 resection (P < 0.001). Postoperative Grade 3 and Grade 4 complications occurred in 11 (7.7%) and 14 (9.9%). The overall operative mortality rate was 0.7% (1/142). Cox hazard model showed that CCR-0, SB-PCI ≤ 2, differentiated carcinoma, and PCI ≤ 10 were the independent favorite prognostic factors. Conclusions. Complete cytoreduction, PCI, SB-PCI threshold, and histologic type were the independent prognostic factors.

Morbidity and Mortality Outcomes of Cytoreductive Surgery and Hyperthermic Intraperitoneal Chemotherapy at a Single Institution in Japan

Background. Even though cytoreductive surgery (CRS) and hyperthermic intraperitoneal chemotherapy (HIPEC) are associated with a high morbidity and mortality rates, it has been reported that CRS and HIPEC improved survival of selected patients with peritoneal carcinomatosis. We aimed to report morbidity and mortality results of CRS and HIPEC from a single institution in Japan. Methods and Results. Total of 284 procedures of CRS were performed on patients with pseudomyxoma peritonei, peritoneal carcinomatosis (PC) from colon cancer and gastric cancer between 2007 and 2011 in our institution. The morbidity rate was 49% of all procedure, and grades I/II and grades III/IV complications were 28% and 17%, respectively. Most frequent complication was surgical site infections including intraabdominal abscess. The mortality rate was 3.5%, and reoperation was needed in 11% of all procedures. Univariate and multivariate analysis showed peritoneal carcinomatosis index (PCI) greater than 20 was the only significant factor for occurrence of postoperative complications (P < 0.01). In contrast, HIPEC significantly reduced postoperative complications (P < 0.05). Conclusions. The morbidity and mortality rates of our institution are comparable with previous reports that are in acceptable rates. Optimal patient selection such as patients with PCI less than 20 seems to be of paramount importance to CRS and HIPEC.

Could prolactin receptor gene polymorphism play a role in pathogenesis of breast carcinoma

SUMMARY Objective: Constitutive activation of various hormone and growth factor receptors is newly recognised as a common cause of tumour development. This study investigated the presence of any mutation or polymorphism of prolactin receptor (PRLR) in 38 patients with breast cancer. Research methods: Genomic DNA was extracted and PCR amplification was carried out for exon 1–10 of PRLR from tumoral and adjacent non-cancerous breast tissue of tumour specimens from 38 breast cancer patients. PCR products were analysed by SSCP and automatic sequencing for mutations. Results: For the first time, A150C (Leu→Ile) transversion at exon 6 of PRLR in tumour tissues, in adjacent non-cancerous breast tissues, and in blood samples of two (5.3%) out of 38 patients with breast cancer were detected. In contrast to this finding, no polymorphism of PRLR in blood samples of 100 normal individuals were found. Conclusion: Polymorphism of prolactin receptors might play a role in mammary carcinogenesis as a consequence of intracellular changes of PRLR signalling.

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.

Dual Inhibition of Wound Healing and Oxidative Process by Montelukast in Experimental Colon Anastomoses

Background. The authors aimed to investigate the effects of montelukast (ML) on the experimental rat colon anastomosis. Methods. A total of 80 Wistar albino rats were divided into 4 groups: sham-operated, colon anastomosis, and colon anastomosis with oral administration (OAML) and rectal administration of 10 mg/kg/d ML (RAML). Anastomotic bursting pressure, anastomotic hydroxyproline contents, malondialdehyde (MDA), glutathione (GSH), glutathione peroxidase (GPX), and superoxide dismutase (SOD) levels, and the expressions of Ki-67, vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (bFGF) with immunohistochemistry were assessed on postoperative day 5. Results . Anastomotic bursting pressures and bFGF expressions were not changed, whereas tissue hydroxyproline concentrations and MDA levels and the expressions of Ki-67 and VEGF were significantly decreased, and GSH, GPX, and SOD levels were significantly increased in the OAML and RAML groups. Conclusion. ML causes impairment of wound healing without altering the anastomosis bursting pressure and reverses the oxidative damage of the colon anastomoses in rats.

Ethyl pyruvate protects colonic anastomosis from ischemia-reperfusion injury.

Ethyl pyruvate is a simple derivative in Ca+2- and K+-containing balanced salt solution of pyruvate to avoid the problems associated with the instability of pyruvate in solution. It has been shown to ameliorate the effects of ischemia-reperfusion (I/R) injury in many organs. It has also been shown that I/R injury delays the healing of colonic anastomosis. In this study, the effect of ethyl pyruvate on the healing of colon anastomosis and anastomotic strength after I/R injury was investigated. Anastomosis of the colon was performed in 32 adult male Wistar albino rats divided into 4 groups of 8 individuals: (1) sham-operated control group (group 1); (2) 30 minutes of intestinal I/R by superior mesenteric artery occlusion (group 2); (3) I/R+ ethyl pyruvate (group 3), ethyl pyruvate was administered as a 50-mg/kg/d single dose; and (4) I/R+ ethyl pyruvate (group 4), ethyl pyruvate administration was repeatedly (every 6 hours) at the same dose (50 mg/kg). On the fifth postoperative day, animals were killed. Perianastomotic tissue hydroxyproline contents and anastomotic bursting pressures were measured in all groups. When the anastomotic bursting pressures and tissue hydroxyproline contents were compared, it was found that they were decreased in group 2 when compared with groups 1, 3, and 4 (P < .05). Both anastomotic bursting pressure (P = .005) and hydroxyproline content (P < .001) levels were found to be significantly increased with ethyl pyruvate administration when compared with group 2. When ethyl pyruvate administration doses were compared, a significant difference was not observed (P > .05). Ethyl pyruvate significantly prevents the delaying effect of I/R injury on anastomotic strength and healing independent from doses of administration.