Erika Randerath

Base analysis of ribopolynucleotides by chemical tritium labeling: An improved mapping procedure for nucleoside trialcohols

Abstract Excellent separations of tritium-labeled nucleoside trialcohols, derived from RNA by enzymic digestion and chemical tritium incorporation, are obtained on thin layers of fibrous cellulose. A comparison shows this procedure to be superior to the separation of these compounds on layers of microcrystalline cellulose in respect to both resolution and precision of quantitative analysis.

Base composition studies on mitochondrial 4 S RNA from rat liver and Morris hepatomas 5123D and 7777

The major and modified base composition of mitochondrial 4 S RNA from rat liver and from Morris hepatomas 5123D and 7777 has been determined for 16 constituents using a chemical tritium-derivative method. The base composition of these mitochondrial 4 S RNA preparations was compared with the base composition of cytoplasmic and bacterial (Escherichia coli B and Bacillus subtilis) 4-S RNAs. The results of these studies are: 1. When compared with cytoplasmic 4 S RNA, the liver and hepatoma mitochondrial 4-S RNAs are characterized by high (A + U)/(G + C) ratios and low overall degrees of base methylation and modification. 2. The mammalian mitochondrial 4-S RNAs are qualitatively even more different from the bacterial 4-S RNAs than from their cytoplasmic counterparts. Thus, several modified constituents found in both cytoplasmic and mitochondrial 4 S RNA are absent from the bacterial 4-S RNAs. 3. Mitochondrial 4S RNA from both hepatomas was found to be under-methylated and undermodified when compared with normal liver mitochondrial 4S RNA. This trend is more pronounced for the rapidly growing hepatoma 7777 (i.e., 17% undermethylation) than for the more slowly growing hepatoma 5123D (i.e., 8% undermethylation). These findings are discussed in relationship to (1) results of other authors on composition of mitochondrial 4 S RNA, (2) special features of structure and biosynthesis of mitochondrial 4 S RNA, (3) the possible evolutionary origin of mitochondria and (4) the possible role played by aberrant mitochondrial 4 S RNA in altered mitochondrial protein synthesis in tumors.

Base analysis of ribopolynucleotides by tritium incorporation following analytical polycrylamide gel electrophoresis

Abstract A procedure is described for tritium base composition analysis of major and modified constituents of 4S RNA following extraction of the RNA from analytical slab gels. Gel electrophoresis and isolation of RNA are shown not to lead to chemical alterations of RNA bases, degradation or preferential losses of RNA species.

Structural analysis of nonradioactive rna by postlabeling: The primary structure of baker's yeast tRNACUALeu

Summary The sequence of tRNA CUA Leu from bakers yeast was determined by application of novel postlabeling methods. Oligonucleotides in complete and partial RNase digests (A, T 1 , and U 2 ) were resolved by chromatography on polyethyleneimine-cellulose thin layers. Nucleotide sequences were elucidated by NaIO 4 /phosphatase or snake venom phosphodiesterase/phosphatase digestion and tritium postlabeling. A ribose-methylated constituent (Gm) was identified by 5′-terminal [ 32 P]-labeling. tRNA CUA Leu is the first biological macromolecule to be sequenced according to a postlabeling scheme.

Chemical post-labeling methods for the base composition and sequence analysis of RNA

Abstract A method for determining the major and minor base composition of ribopolynucleotides by tritium derivatization is presented, which consists of the following steps: 1. enzymatic digestion of the ribopolynucleotide to a mixture of nucleosides; 2. oxidation of the digest with periodate; 3. reduction with tritiated borohydride to labeled nucleoside derivatives; 4. two-dimensional thin-layer chromatography on cellulose; 5. detection of tritium-labeled derivatives by fluorography; 6. liquid scintillation counting The method is extremely sensitive: tritium-labeled digest derived from less than 1 μg of polynucleotide is required for evaluation of the base composition. It is particularly well suited for assaying the modified bases in transfer RNA. Several schemes for sequence analysis by post-labeling of non-radioactive RNA on an ultramicro-analytical scale are discussed. For sensitive detection of tritium-labeled spots on chromatograms, a fluorographic film procedure has been developed.

Rat liver mitochondrial lysine tRNA (anticodon U∗UU) contains a rudimentary D-ARM and 2 hypermodified nucleotides in its anticodon loop

Abstract A lysine tRNA (anticodon U∗UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm1Am2GCUUAGAGCm2GUUAACCU U ∗ UU -t6AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCAOH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U∗27 (probably 5-methoxycarbonylmethyluridine) and t6A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U∗ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t6A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.

Base analysis of RNA by 3H postlabeling — A study of ribothymidine content and degree of base methylation of 4 S RNA

Abstract 1. Ribothymidine (5-methyluridine) and methylated base content of 4 S RNA from various sources have been determined. 2. Whereas bacterial 4-S RNAs contain one mole of ribothymidine per mole of RNA and have a low degree of base methylation, mammalian cytoplasmic 4-S RNAs, e.g. from rat liver, muscle, and brain, were found to contain only 0.45 to 0.5 mole of ribothymidine per mole of RNA and to have a methylated base content about three times higher than that of bacterial 4S RNA. 3. Cytoplasmic 4-S RNAs from Morris Hepatomas 7777 and 5123D are slightly undermethylated when compared with liver 4 S RNA, the ribothymidine content being slightly lower (Hepatoma 7777) or equal (Hepatoma 5123D). Pellet (15 000 × g ) 4-S RNAs contain less ribothymidine and methylated bases than do the respective cytoplasmic 4-S RNAs. These differences are more pronounced for the tumor 4-S RNAs. 4. Mitochondrial 4-S RNAs from liver and Hepatomas 5123D and 7777 contain about 3 to 5 times less ribothymidine and about 2 times less methylated bases than does liver cytoplasmic 4 S RNA, ribothymidine and methylated base content of mitochondrial 4 S RNA being lower for the tumors than for liver.

The sequence of mitochondrial arginine tRNA (anticodon UCG) from a transplantable rat tumor, morris hepatoma 5123D

Mammalian mitochondria contain a distinct genome of closed-circular duplex DNA of about 16.5 kb [ 1,2] coding for 12 S and 16 S rRNAs, 22-23 tRNAs, and a number of mitochondrial (mt) proteins [2-41. Mt tDNA codes for unusually short mature tRNAs and apparently lacks information for leader, trailer, and intervening sequences [ 51. Most mammalian mt tRNA sequences have been inferred by DNA sequencing while until recently only mt serine tRNAs (anticodon GCU) from beef heart [6], beef liver [7], and hamster BHK-21 cells [8] have been sequenced directly. As part of a project to elucidate the structural basis for differences in base composition between rat liver and hepatoma mt tRNA [9], we have recently sequenced several tRNAs from the mitochondria of a transplantable rat tumor, Morris hepatoma 5 123D, including tRNA&& [lo], tRNAgzc [ll], tRNA

Base composition studies on transfer RNA from normal and regenerating rat liver

[ 121, tRNAE%A and tRNAEfcA (unpublished). Here we report the sequence of mt tRNA@& from this tumor. The hepatoma mt tRNAArg exhibits about 86% sequence homology with the DNA-derived putative sequence of human placenta mt tRNA*g [2]. Differences, including transitions and transversions, were found in acceptor stem and ‘D-stem’ close to the center of the cloverleaf structure and in loops I, III and IV The sensitive thin-layer readout procedure for RNA sequence analysis of Gupta and Randerath [ 13,141 enables one to identify and locate about 20 modified nucleotides in small amounts of tRNA (-0.5 pg). Information on modified nucleotides in mammalian mt tRNA can be obtained only by direct RNA sequencing. The hepatoma arginine tRNA was found 2

Tumor mitochondrial transfer RNAS: The nucleotide sequence of mitochondrial tRNALeuUAG from morris hepatoma 5123D

residues (positions 29 and 36) and m’ A in position 9. The unusual occurrence of m’A at this