Éva Ajzner

Multifunctional specificity of the protein C/activated protein C Gla domain

Activated protein C (APC) has potent anticoagulant and anti-inflammatory properties that are mediated in part by its interactions with its cofactor protein S and the endothelial cell protein C receptor (EPCR). The protein C/APC Gla domain is implicated in both interactions. We sought to identify how the protein C Gla domain enables specific protein-protein interactions in addition to its conserved role in phospholipid binding. The human prothrombin Gla domain, which cannot bind EPCR or support protein S cofactor activity, has 22/45 residues that are not shared with the human protein C Gla domain. We hypothesized that the unique protein C/APC Gla domain residues were responsible for mediating the specific interactions. To assess this, we generated 13 recombinant protein C/APC variants incorporating the prothrombin residue substitutions. Despite anticoagulant activity similar to wild-type APC in the absence of protein S, APC variants APC(PT33-39) (N33S/V34S/D35T/D36A/L38D/A39V) and APC(PT36/38/39) (D36A/L38D/A39V) were not stimulated by protein S, whereas APC(PT35/36) (D35T/D36A) exhibited reduced protein S sensitivity. Moreover, PC(PT8/10) (L8V/H10K) displayed negligible EPCR affinity, despite normal binding to anionic phospholipid vesicles and factor Va proteolysis in the presence and absence of protein S. A single residue variant, PC(PT8), also failed to bind EPCR. Factor VIIa, which also possesses Leu-8, bound soluble EPCR with similar affinity to wild-type protein C, collectively confirming Leu-8 as the critical residue for EPCR recognition. These results reveal the specific Gla domain residues responsible for mediating protein C/APC molecular recognition with both its cofactor and receptor and further illustrate the multifunctional potential of Gla domains.

Severe bleeding complications caused by an autoantibody against the B subunit of plasma factor XIII: a novel form of acquired factor XIII deficiency

Acquired factor XIII (FXIII) deficiency due to autoantibody against FXIII is a very rare severe hemorrhagic diathesis. Antibodies directed against the A subunit of FXIII, which interfere with different functions of FXIII, have been described. Here, for the first time, we report an autoantibody against the B subunit of FXIII (FXIII-B) that caused life-threatening bleeding in a patient with systemic lupus erythematosus. FXIII activity, FXIII-A(2)B(2) complex, and individual FXIII subunits were undetectable in the plasma, whereas platelet FXIII activity and antigen were normal. Neither FXIII activation nor its activity was inhibited by the antibody, which bound to structural epitope(s) on both free and complexed FXIII-B. The autoantibody highly accelerated the elimination of FXIII from the circulation. FXIII supplementation combined with immunosuppressive therapy, plasmapheresis, immunoglobulin, and anti-CD20 treatment resulted in the patients recovery. FXIII levels returned to around 20% at discharge and after gradual increase the levels stabilized above 50%.

Comparison of PFA-100 Closure Time and Template Bleeding Time of Patients with Inherited Disorders Causing Defective Platelet Function

MINI REPORT Comparison of PFA-100 Closure Time and Template Bleeding Time of Patients with Inherited Disorders Causing Defective Platelet Function Adrienne Kerenyi1, Agota Schlammadinger2, Eva Ajzner1, Istvan Szegedi3, Csongor Kiss3, Zoltan Pap4, Zoltan Boda2 and Laszlo Muszbek1 1Department of Clinical Biochemistry and Molecular Pathology, 2Second Department of Medicine, 3Department of Pediatrics, University Medical School of Debrecen, Debrecen, 4City Health Service, Ophthalmology Unit, Debrecen, Hungary.

Factor V Leiden as a risk factor for miscarriage and reduced fertility

Summary: The Leiden mutation is a recent discovery. It is the main cause of inherited thrombophilia and has been found in 20–60% of deep vein thrombosis cases. More recently it has been found in a significant number of cases of obstetric complications attributable to placental thrombosis. Current patient management practice for dealing with the Leiden mutation is based mainly on information about deep vein thrombosis because there is little information on pregnancy complications. There are no prospective studies examining the risk of developing pregnancy complications for Leiden mutation carriers. The aim of this study is to do that by comparing the frequency of unfavourable pregnancy outcomes among carriers with those among controls. The number of women developing miscarriages, intrauterine deaths, or infertility problems among 128 Leiden mutation carriers was compared with the number among 461 controls. The risk of having at least one miscarriage or infertility problems was 1.5 times greater for Leiden mutation carriers than controls. This result was statistically significant (95% CI 1.2, 2.7). The risk of having at least two miscarriages or infertility problems was 2.5 times greater for Leiden mutation carriers than controls. This was also statistically significant (95% CI 1.2, 5.13).

Enzyme-linked immunosorbent assay for the determination of blood coagulation factor XIII A-subunit in plasma and in cell lysates.

A new one-step ELISA was developed for the determination of the concentration of blood coagulation factor XIII subunit A (FXIII-A) in plasma and in cell lysates. Monoclonal antibodies directed against different epitopes on FXIII-A were used for the assay. The capture antibody was biotinylated on its carbohydrate moiety and the detection antibody was labelled with horseradish peroxidase. The antigen-antibody reaction was carried out in the well of a streptavidin-coated microplate. Complex formation with FXIII subunit B (FXIII-B) and association to fibrinogen did not influence the accessibility of the antibodies to FXIII-A. The method could be performed within 2 h and demonstrated good reproducibility, recovery and sensitivity. Plasma samples could be assayed after storage at -20 degrees C for at least 6 months. However, in the case of platelet lysates freezing and rethawing resulted in a significant loss of FXIII-A. FXIII-A concentrations measured in the plasma samples of healthy individuals and patients correlated well with the concentrations of complexed plasma FXIII (A2B2) and with the results of FXIII activity measurements. A reference range of 46-82 fg/platelet was established for platelet FXIII-A.

Prophylactic and perioperative replacement therapy for acquired factor XIII deficiency: a rebuttal

protein for the sequence UCUUC which would be abolished due to the deletion of TTCT in our hemophilia B patient (Fig. 1a,b). Examples of short deletions disrupting this site within the polypyrimidine tract have been previously reported [10] but they have not been supported by mRNA sequence data. A common feature of short (< 20 bp) deletions is the presence of direct repeats of between 2 bp and 8 bp within the immediate vicinity of the deletion. In some cases the repeatmay be overlapping [11]. In the sequence region covering our patient’s deletion there is a TCTT overlapping repeat (TTTGTCTTCTTTTAT) and also a TTCTTT repeat separated by 2 bp (TTTGTCTTCTTTTATTCTTTATAG). The underlying causative mechanism may well involve these direct repeats and some form of recombination, replication or repairbased model of deletion mutagenesis. We have described a novel mutation and the production of both normal and exon skipped mRNA splicing products covering FIX exons b, c and d.We propose that as a result of a four-base deletion (TTCT) within the polypyrimidine tract of exon b, the normal mRNA splicing mechanism is disrupted. The aberrant mRNA splicing observed in our hemophilia B patient supports a mechanism of polypyrimidine tract shortening and/or elimination of a specific binding site essential for spliceosome formation. Contrary to previous reports in this journal [1,2], the results presented here indicate that perhaps full-length FIX transcript is produced as illegitimately transcribed mRNA derived from peripheral blood leukocytes and is therefore a useful tool for the analysis of genetic defects involving splicing abnormalities. References

Anti-factor V auto-antibody in the plasma and platelets of a patient with repeated gastrointestinal bleeding

Summary.  Development of autoantibody against coagulation factor V (FV) is a rare clinical condition with hemorrhagic complications of varying severity. The aim of this study was to establish the pathomechanism of an acquired FV deficiency and characterize the FV inhibitor responsible for the clinical symptoms. A 78‐year‐old female was admitted to hospital with severe gastrointestinal bleeding. General clotting tests and determination of clotting factors were performed by standard methods. FV antigen and FV containing immune complexes were measured by ELISA. The FV molecule was investigated by Western blotting and by sequencing the f5 gene. The binding of patients IgG to FV and activated FV (FVa) was demonstrated in an ELISA system and its effect on the procoagulant activity of FVa was tested in clotting tests and in a chromogenic prothrombinase assay. Localization of the epitope for the antibody was performed by blocking ELISA. FV activity was severely suppressed both in plasma and platelets. FV antigen levels were normal by ELISA using polyclonal anti‐FV antibody or monoclonal antibody against the connecting region of FV, but depressed when HV1 monoclonal antibody against the C2 domain in the FV light‐chain was used as capture antibody. The FV molecule was found intact. An IgG reacting with both FV and FVa was present in the patients plasma and its binding to FV was inhibited by HV1 antibody. FV‐containing immune complexes were detected in the patients plasma and platelet lysate. The patients IgG inhibited the procoagulant function of FVa. An anti‐FV IgG was present in the patients plasma and platelets. The autoantibody reacted with an epitope in the C2 domain of FV light chain and neutralized the procoagulant function of FVa.

Thrombotic and fibrinolytic alterations in the aseptic necrosis of femoral head

&NA; Recent reports seem to support the role of the thrombophilia and decreased fibrinolysis in the aetiopathogenesis of aseptic necrosis of bone. In the present study, haemostatic disturbances were analysed in adults (n = 49) and patients in childhood (Perthes disease) (n = 47) with aseptic necrosis of the femoral head. Fibrinolytic parameters (in vitro clot lysis, plasminogen, plasmatic plasminogen activator inhibitor‐1 activity, D‐dimer) along with lipoprotein (a) [Lp(a)] and fibrinogen were measured. von Willebrand factor, platelet activation and some thrombophilic factors (activated protein C resistance and factor V Leiden mutation, protein C, protein S activity) were also determined. Impaired fibrinolysis, an increased Lp(a) level along with slow clot lysis and increased platelet activation were found in adult cases. We detected five cases of factor V Leiden mutations (one heterozygotic and four homozygotic) among patients with Perthes disease. The clinical course of the heterozygous case was similar to the usual form of Perthes disease. The most severe form of Perthes disease has been observed in homozygous factor V Leiden mutation cases. The mutation of factor V Leiden per se probably does not induce the development of aseptic necrosis of bone tissue in childhood, but it does play a role in its acceleration. Homozygous factor V Leiden mutation definitely runs a more severe course. On the other hand, in adult cases, the disturbances of haemostasis, impaired fibrinolysis, elevated Lp(a) level, increased platelet activation and slight elevation of fibrinogen might have clinical relevance. Further studies should focus on proving the role of the haemostatic alterations in the pathogenesis of severe forms of aseptic bone necrosis. The use of antithrombotic drugs in order to slow the process of aseptic necrosis also has to be addressed in future surveys. Blood Coagul Fibrinolysis 14:243‐248

Analysis of complement factor H Y402H, LOC387715, HTRA1 polymorphisms and ApoE alleles with susceptibility to age‐related macular degeneration in Hungarian patients

Purpose:  Recent studies strongly support the role of genetic factors in the aetiology of age‐related macular degeneration (AMD). We investigated the frequency of Tyr402His polymorphism of the complement factor H (CFH) gene, Ser69Ala polymorphism at LOC387715, rs11200638 polymorphism of the HTRA1 gene and different apolipoprotein E (ApoE) alleles in Hungarian patients with AMD in order to determine the disease risk conferred by these factors.

Natural coagulation inhibitor proteins in young patients with cerebral ischemia

Disturbances of coagulation and fibrinolytic pathways were studied in 53 young patients with cerebral ischemia. Upon admission 26 of 53 patients had abnormality in at least one of the antithrombin-III, protein C, protein S activities or in activated protein C (APC) ratios. Three months after the first examination the majority of the previously detected abnormalities returned to normal values and the most frequent alterations were decrease in protein S activity (3 patients) and APC resistance (3 patients). Conditions resulting in impaired fibrinolysis were frequently detected upon admission. Elevation of plasminogen activator inhibitor-1, lipoprotein (a), and alpha-2-antiplasmin was present in 23, 10, and 4 cases, respectively. It is concluded that abnormalities of coagulation as well as of the fibrinolytic systems are prevalent in the acute phase of cerebral ischemia, however, the results may be significantly influenced by the disease process or the acute phase effect.