Fan Li

First report of tomato mottle mosaic virus infection of pepper in China.

Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China. References: (1) R. Li et al. J. Virol. Methods 154:48, 2008. (2) R. Li et al. Genome Announc. 1(5):e00794-13, 2013. (3) Y. Xie et al. Virol. J. 10:142, 2013.

Simultaneous detection of four causal agents of tobacco bushy top disease by a multiplex one-step RT-PCR.

Tobacco bushy top disease is a complex disease caused by mixed infection of Tobacco bushy top virus (TBTV), Tobacco vein distorting virus (TVDV), satellite RNA of TBTV (Sat-TBTV) and Tobacco vein distorting virus associate RNA (TVDVaRNA). A one-tube multiplex reverse transcription-PCR (RT-PCR) assay was developed for simultaneous detection of the four causal agents of the disease. Four pairs of specific primers based on the conserved regions of each of the four disease agents were used in the one-tube RT-PCR. The RT-PCR products consisted of fragments of 1049 base pairs (bp) for TBTV, 792bp for TVDVaRNA, 598bp for Sat-TBTV and 357bp for TVDV, and their origins were confirmed by sequencing. Primer concentrations and cycling condition were optimized for the multiplex RT-PCR. The detection limit of the assay was up to 10(-4) dilution. The assay was evaluated using tobacco plants infected naturally with one to four target viruses, transmission vector of aphids and field samples collected from Yunnan, Hunan, and Guizhou province, China. The results show that the multiplex RT-PCR is reliable and sensitive as a simple, rapid and cost-effective method to detect these pathogens in tobacco and aphid. This assay will be useful for virus surveys when large numbers of samples are tested.

First Report of Rhizome Blight of Ginger Caused by Binucleate Rhizoctonia AG-R in China

In 2004, rhizome blight of ginger (Zingiber officinale (Willd.) Roscoe) (cv. Yunnanxiaojiang) occurred in the Kunming District of China. The surface of ginger rhizome after harvest was crimpled and covered with white hyphae. Initial symptoms on ginger were wilting on the stem and the color of the rhizome turned from white to light brown with no lesion formation. After 2 weeks, the surface of ginger rhizome was covered with white hyphae and a dry rot set in under humid conditions. The yield loss in ginger almost reached 50% because of the disease. An AG-R tester isolate paired with the unknown 37 isolates of Rhizoctonia spp. from the diseased ginger rhizomes caused a C2 reaction that confirmed their identity. Isolates of AG-R (GenBank Accession Nos. DQ885780 and DQ885781) had 100% sequence similarity with 5.8S rDNA-ITS with the AG-R tester isolate (GenBank Accession No. AF354082). To produce infected soil inoculum, 10 isolates were cultured on potato dextrose agar in a 9-cm petri dish for 3 to 4 days and then covered with approximately 20 g of autoclaved soil and kept at 25°C for 3 to 4 days. Seedlings of ginger (cv, Yunanxiaojiang) were planted in natural potting soil at a density of one plant per vinyl pot (8 cm in diameter, 9 cm high) and grown in the greenhouse for 7 days. Each seedling was inoculated with 7 g of infested soil by placing it around the rhizome. Control plants were inoculated with autoclaved soil. The experiments were carried out three times, each time with three replicates in a growth chamber kept at 25 and 16°C with a 16-h light and 8-h dark photoperiod. After 14 days, the disease severity was recorded based on a scale in which - = no symptoms; + = small lesions on seedlings, no blight; ++ = seedling blight; and +++ = plant dead. All of the 10 tested AG-R isolates caused ginger seedling blight. Rhizoctonia spp. was reisolated from these plants, confirming its pathogenicity. To our knowledge, this is the first report of rhizome blight of ginger caused by Rhizoctonia spp. and binucleate Rhizoctonia AG-R in China. References: (1) B. Sneh et al. Page 135 in: Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1998.

Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay

A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China.nnnRESULTSnshowed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested.

Detection of tobamoviruses by RT-PCR using a novel pair of degenerate primers

A generic RT-PCR assay was developed for the universal detection of viruses of the genus Tobamovirus using a novel pair of degenerate primers designed based on conserved regions on replicase genes of 32 tobamoviruses. The assay detected nine tobamoviruses, including six Solanaceae-infecting subgroup tobamoviruses of Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), Tomato mottle mosaic virus (ToMMV), Tobacco mottle green mosaic virus (TMGMV), Pepper mild mottle virus (PMMoV), Paprika mild mottle virus (PaMMV), one Orchidaceae-infecting tobamovirus of Odontoglossum ringspot virus (ORSV) and two Cucurbitaceae-infecting subgroup tobamoviruses of Cucumber green mottle mosaic virus (CGMMV) and Zucchini green mottle mosaic virus (ZGMMV), with high amplification efficiency, specificity and sensitivity. The assay was applied to detect tobamoviruses in pepper and tomato fields. Five tobamoviruses, PMMoV, TMV, ToMV, ToMMV and TMGMV, were detected from the pepper fields in single and mixed infections. Single infections of PMMoV, ToMV and ToMMV and mix-infection of ToMVu202f+u202fPMMoV were detected from the tomato fields. Among these viruses, PMMoV was first detected from tomato worldwide, while ToMMV was first detected from tomato plants in China. This generic assay is simple, cost-effective and has great potential to detect more tobamoviruses in the field.

Complete genome sequence of yam chlorotic necrosis virus, a novel macluravirus infecting yam

The complete genome sequence of a novel member of the genus Macluravirus was determined from yam plants with chlorotic and necrotic symptoms in China. The genomic RNA consists of 8,261 nucleotides (nt) excluding the 3’-terminal poly(A) tail, containing one long open reading frame (ORF) encoding a large putative polyprotein of 2,627 amino acids. Its genomic structure is typical of macluraviruses, which lack the P1 protein, N-terminal HC-Pro, and D-A-G motif for aphid transmission that are found in potyviruses. The virus shares 56.3-63.8% sequence identity at the genome sequence level and 49.7-63.9% at the polyprotein sequence level with other members of the genus Macluravirus. Phylogenetic analysis based on the complete polyprotein sequence of representative members of the family Potyviridae clearly places the virus within the genus Macluravirus. These results suggest that the virus, tentatively named “yam chlorotic necrosis virus” (YCNV), should be considered a member of a novel species in the genus Macluravirus.

First Report of Tomato yellow leaf curl China virus with Betasatellite Infecting Panax notoginseng

Panax notoginseng, an important medicinal herb commonly known as notoginseng, san qi, or tian qi, is in the family Araliaceae. The herb is mainly cultivated in Guangxi and Yunnan provinces of southern China for its root, which is used in Chinese herbal medicine to treat various blood disorders. In December 2012, Panax yellowing was observed in several notoginseng farms with prevalence of 5 to 10% in Wenshan, Yunnan Province. Foliar symptoms included yellowing, shrinking, curling, and blistering. Leaf samples collected from 15 symptomatic plants were initially tested by negative staining electron microscopy, and no distinct virions were observed. Total nucleic acids were extracted from these samples by a CTAB method and used as templates in RT-PCR for presence of criniviruses, tobamoviruses, and tospoviruses, but results were negative. Infestation of whiteflies (Bemisia tabaci) has been a problem on these farms in recent years, suggesting a whitefly-transmitted begomovirus as potential causal agent. To explore this possibility, the samples were tested by PCR using degenerate primers BegoAFor1 and BegoARev1 described by Ha et al. (3). Amplicons of ~1.2 kbp were obtained from 12 out of 15 samples, indicating the presence of a putative begomovirus. These amplicons were cloned and sequenced in both directions. BLAST search showed that they had high sequence identities (94 to 95%) to the genome of Tomato yellow leaf curl China virus (TYLCCNV). A pair of virus-specific primers, TYLCCNVFa (5-TGRTAGGWACYTGAGTAGAGTGG-3) and TYLCCNVRa (5-TCRTCCATCCATATCTTCCCAA-3), was then designed and used to amplify the remaining genomic sequence. The full-length genomic sequence of one isolate, YWSh03, was determined to be 2,733 nt (KJ477327). Sequence comparison showed that the genome of YWSh03 shared 96.2% nucleotide sequence identity with that of TYLCCNV-[G102] (AM050555). PCR using primers Beta01 and Beta02 (1) was also tested for the association of betasatellite with this virus. A DNA fragment was obtained from isolate YWSh03, and its sequence was determined to be 1,336 bp (KJ477326). This sequence has 99.9% nucleotide sequence identity to Tomato yellow leaf curl China betasatellite (TYLCCNB) [Y10] (AJ421621). The results show that TYLCCNV, a virus infecting tomato, tobacco, kidney bean, and several weeds (2), is also associated with the yellowing disease in P. notoginseng. To determine whether TYLCCNV and TYLCCNB might cause disease on P. notoginseng, infectious clones of TYLCCNV and TYLCCNB provided by Dr. Xueping Zhou (Zhejiang University, China) were used to inoculate to 44 healthy P. notoginseng plants by an Agrobacterium-mediated method. Thirty-four inoculated plants showed typical symptoms of yellowing, curling, and stunting, confirming TYLCCNV and TYLCCNB are the causal agents of the disease. To further investigate the distribution and incidence of the virus, 258 symptomatic P. notoginseng samples were collected from 18 fields in Wenshan, Honghe, Qujing, and Kunming of Yunnan Province and tested by PCR with TYLCCNV-specific primers of TYLCCNVdF (5-CCTGTATATGCGACTTTGAAAGT-3) and TYLCCNVdR (5-CCCAATTCCAGCTATAAAGAGTA-3). The virus was detected in 149 samples (57.8%), indicating that TYLCCNV infection of P. notoginseng is common. However, the agent causing the disease in the 109 symptomatic plants lacking TYLCCNV remains under investigation. To our knowledge, this is the first report of TYLCCNV with TYLCCNB infecting P. notoginseng and the family Araliaceae. References: (1) R. W. Briddon et al. Mol Biotechnol. 20:315, 2002. (2) J. H. Dong et al. Plant Pathol. 56:342, 2007. (3) C. Ha et al. J. Gen. Virol. 87:997, 2006.