Fevzi Bardakci

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.

Type I cystinuria and its genetic basis in a population of Turkish school children

Objectives:  Cystinuria is a common inherited disorder characterized by an abnormal urinary excretion of cystine and dibasic amino acids resulting in nephrolithiasis. The SLC3A1 gene, which encodes a dibasic amino acid transporter protein, is involved in the pathogenesis of cystinuria. In the present study we aimed to investigate the prevalence of cystinuria among children in Sivas province (Central Anatolia, Turkey) and to study M467T and M467K mutations and 231T/A polymorphism in patients with cystinuria.

Genetic Structure of Brown Trout ( Salmo trutta ) Populations from Turkey Based on Microsatellite Data

This present study investigated micro- and macro-geographic microsatellite DNA variations using five polymorphic microsatellite loci from 27 brown trout populations in Turkey. Average number of alleles and average observed heterozygosity were 7.4 and 0.254, respectively. Even populations from the same sea basin and river system (the so called micro-geographic regions) had unique alleles. Genetic variation among the populations from macro-geographic regions (different sea basins and river systems) was 45.78%. The mtDNA lineages of brown trout that have previously been identified by mtDNA analyses were supported by the analysis of the microsatellite DNA data in general. The Çatak population, which belongs to the Tigris lineage, was clustered together with the Euphrates populations within the Adriatic mtDNA lineage, based on microsatellite data. Both mitochondrial and microsatellite DNA analyses have made it possible to determine a secondary contact between Adriatic and Tigris lineages.

Genetic Structure of Anchovy Engraulis encrasicolus in the Adriatic Sea using Microsatellite DNA Analysis

Stock structure analysis of anchovy from the Rovinj, Maslenica and Island of Korculain in the Adriatic Sea was carried out by using 13 microsatellite loci. Overall, 259 alleles were detected in 13 loci, the number of alleles per locus and population ranged from 4 to 28. The allelic richness of overall loci was found to be highest in the Rovinj population and lowest in the Island of Korcula population. The highest and lowest value of population specific alleles was found in the Rovinj population and Island of Korcula population, respectively. Observed heterozygosity per population was ranged from 0.714 (Rovinj) to 0.678 (Maslenica). Pairwise FST values revealed that there is no significant genetic differences between populations (P>0.05). However, the highest and lowest genetic distance were found between the Rovinj and Maslenica populations (FST=0.00626) and between the Island of Korcula and Maslenica populations, respectively. The UPGMA dendrogram clustered the Maslenica and Island of Korcula populations together, and the Rovinj population was a distinct cluster from these two.

Analysis of a 1-year-old cystinuric patient with recurrent renal stones

Abstract  Cystinuria is a hereditary disorder of cystine and dibasic amino acids (lysine, arginine, ornithine) transport across the luminal membrane of renal tubules and intestine, resulting in recurrent nephrolithiasis. Cystine stones frequently occur in the second or third decade of life with an occasional occurrence in infancy and in old age. Herein is presented the case of a 1‐year‐old girl with cystinuria and recurrent urolithiasis; the genetic basis of the disease was investigated by mutational analysis of the SLC3A1 gene. The data show that the present patient has an increased cystine (923.08 µg/mL) level and was heterozygote for M467T mutation.