Gaetano Alberghina

Dimerization of Cibacron Blue F3GA and other dyes: influence of salts and temperature

Abstract The monomer–dimer equilibria of Cibacron Blue F3GA (CB) and five other dyes (Levafix Brilliant Blue EB, Reactive Scarlet 017, Methyl Orange, Basic Blue 3 and Chicago Blue Sky) have been investigated in water and in the presence of KH 2 PO 4 . Aggregation of CB has been also examined in the presence of NaH 2 PO 4 , LiCl and KCl. When a new iterative approach, based on non-linear least-square (NLLSQ) fitting procedure was applied, it was found that the dimerization constants depend on the extension of organic molecules and the number of sulphonic groups. In the case of CB, cations had a greater effect on the equilibrium than anions. Analysis of the calculated spectra for monomer and dimer of Basic Blue 3 after deconvolution allowed us to specify the geometry of the dimer.

Purification of wheat flour high-Mr glutenin subunits by Reactive Red 120-Agarose and Reactive Yellow 86-Agarose resins

Abstract Two reactive textile dyes were employed to purify some high-Mr glutenin subunit mixtures by dye-ligand chromatography. In particular, the use of the triazine dye Reactive Red 120 coupled to Agarose bed provided an efficient method to purify high-Mr glutenin subunit mixtures, showing high binding capacity and high selectivity for these proteins and assuring a recovery of about 80%. On the other hand, the Reactive Yellow 86 had weaker interaction and a lower selectivity than Red 120 with a recovery of about 60%. However, this dye allowed the separation of some subunits that were not separated by reactive Red 120.

Influence of pH and Ionic Strength on Equilibrium Sorption of Cationic Dyes by Acrylic Fibers

We have investigated the equilibrium sorption of two cationic dyes by acrylic fibers at different pH levels and sodium chloride concentrations. To interpret the data, we used the simple Donnan approach with the assumption that the acrylic fibers contained two different types of acidic groups. The distribution coefficients of the dyes are dis cussed in relation to the structures of the dyes and the fibers and the effect of sodium chloride. The equilibrium sorption at different pH levels gives some indication of the strength of the strongly and weakly acidic groups of the acrylic fibers not directly accessible by experiments.

The dyeing of cellulose with reactive dyes containing phosphonic acid groups

Abstract The fixation of some Procion T phosphonated reactive dyes on cotton in the presence of dicyandiamide in different conditions of dyeing is reported, in order to clarify the role of the carbodiimide in the fixation process. Paper chromatographic studies on Procion Red T-2B show that the reaction mechanism between the phosphonic dye and cellulose in the presence of dicyandiamide is an initial condensation of the phosphonic dye with dicyandiamide to produce a phosphonic acid anhydride, followed by subsequent reaction with cellulose to give a dye covalently bonded to the cellulose. The phosphonic acid anhydride, isolated by means of column chromatography, shows the characteristic adsorption bands of the P—O—P linkage.

Kinetics of Hydrolysis of Dichlorotriazinyl Reactive Azo Dyes

The rate of hydrolysis of some dichlorotriazinyl reactive azo dyes is measured where the triazinyl-ring is attached to a derivative of H-acid in the buffer solutions over the range 25-35°C. The rate constants obtained at constant pH are pseudo-first-order, but they are dependent on the concentration of hydroxyl ion. This dependence of the hydrolysis constants on the hydroxyl ion concentration is explained, supposing that, as the pH of the dye solution increases, ionization of the phenolic hydroxyl group at the 8-positioh in the naphthalene ring occurs to give a less reactive ionized form.

Separation of G structures formed by a 27-mer guanosine-rich oligodeoxyribonucleotide by dye–ligand affinity chromatography

G-DNA structures, formed by a 27-mer guanosine-rich oligodeoxyribonucleotide, AACCCGGCGTTCGGGGGGTACCGGGTT, were isolated and studied by dye-ligand affinity chromatography, using a Reactive Green 19-agarose resin (RG19-aga) and gel electrophoresis. The experiments were performed in the presence of Li+, Na+ and K+, which are able to stabilise the G structures to different extents. Desalting procedures followed by affinity chromatography, performed in the presence of Li+, gave us information on the relationships among the species isolated and their stability. The results show that the more stable species were those obtained in the presence of K+, while in the presence of Li+, the formation of G structures was negligible and the oligonucleotide was almost exclusively present as a stem-loop structure recognised by the RG19-aga affinity resin. Electrophoretic and denaturation and renaturation experiments supported the affinity chromatography results.

Donnan Approach to Equilibrium Sorption: Influence of Electrolytes on Dyeing of Dralon X-100 with CI Basic Blue 3

We have investigated the effects of various electrolytes at different concentrations . on dyeing equilibria of CI basic blue 3 with Dralon X-100, interpreting the data with the Donnan approach. We have tried to separate the contribution of the cations and anions in the electrolytes. The results indicate that both cations and anions have independent effects on dye sorption. With increasing salt concentration, the dye sorp tion decreases, but with sodium and ammonium sulphate, an unusual increase of dye sorption occurs at salt concentrations up to 0.5 mol/l.

Donnan Approach to Equilibrium Sorption: Interactions of Cationic Dyes with Acrylic Fibers

The equilibrium sorption of ten cationic dyes by porous and regular acrylic fibers has been investigated. The data have been interpreted by a simple Donnan approach, based on the assumption that there are two different types of acidic groups in these fibers. The ionic distribution coefficients KD for the dyes and the fibers were calculated. These coefficients provide an indirect measure of the “affinity” of the dyes for the fibers. The values of KD have been discussed in relation to the structures of the dyes and fibers, and in relation to the effects of salts, pH, and temperature.

THE MASS SPECTRA OF SOME THIOPHENE 2- AND 3-CARBOXANILIDES

Abstract Mass spectra of some substituted thiophene-2-carboxanilides and thiophene-3-carboxanilides at 70 eV are reported. Primary main degradation reaction of these compounds occurs by cleavage of the amide bond, followed by CO elimination. The substituent effects on mass spectra are related by the Hammett equation. The plots of log Z/Z0 for substituted thiophene-3-carboxanilides against [sgrave] (r = 0.972; ρ = 0.486) and [sgrave]+ (r = 0.905; ρ = 0.346) are linear. The plot for 3-substituted thiophene-2-carboxanilides against [sgrave] give poor linearity (r = 0.797); ρ = −0.098).

Adsorption thermodynamics and diffusion of disperse anthraquinone dyes in acetate fibre

Abstract Diffusion coefficients, thermodynamic parameters and adsorption equilibrium isotherms of some anthraquinone dyes for acetate fibre are reported. The chemical constitution seems to be more important than the size factor in determining dye diffusion into the interior of the fibres. The activation energies of diffusion decreased strongly when o-dichlorobenzene was present, due to the plasticising effect of carrier. Nernst partition isotherms were obtained, up to saturation. Substantivity decreased when water-solubilising groups are present in the molecule. The aqueous solubilities and heats of solution have been measured; the higher ΔH w values were found for the derivatives which can form intermolecular hydrogen bonding in the crystalline state.