Gene G. Hunder

Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part II.

OBJECTIVE To provide a single source for the best available estimates of the US prevalence of and number of individuals affected by osteoarthritis, polymyalgia rheumatica and giant cell arteritis, gout, fibromyalgia, and carpal tunnel syndrome, as well as the symptoms of neck and back pain. A companion article (part I) addresses additional conditions. METHODS The National Arthritis Data Workgroup reviewed published analyses from available national surveys, such as the National Health and Nutrition Examination Survey and the National Health Interview Survey. Because data based on national population samples are unavailable for most specific rheumatic conditions, we derived estimates from published studies of smaller, defined populations. For specific conditions, the best available prevalence estimates were applied to the corresponding 2005 US population estimates from the Census Bureau, to estimate the number affected with each condition. RESULTS We estimated that among US adults, nearly 27 million have clinical osteoarthritis (up from the estimate of 21 million for 1995), 711,000 have polymyalgia rheumatica, 228,000 have giant cell arteritis, up to 3.0 million have had self-reported gout in the past year (up from the estimate of 2.1 million for 1995), 5.0 million have fibromyalgia, 4-10 million have carpal tunnel syndrome, 59 million have had low back pain in the past 3 months, and 30.1 million have had neck pain in the past 3 months. CONCLUSION Estimates for many specific rheumatic conditions rely on a few, small studies of uncertain generalizability to the US population. This report provides the best available prevalence estimates for the US, but for most specific conditions more studies generalizable to the US or addressing understudied populations are needed.

Estimates of the prevalence of arthritis and selected musculoskeletal disorders in the United States

OBJECTIVE To provide a single source for the best available estimates of the national prevalence of arthritis in general and of selected musculoskeletal disorders (osteoarthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, the spondylarthropathies, systemic lupus erythematosus, scleroderma, polymyalgia rheumatica/giant cell arteritis, gout, fibromyalgia, and low back pain). METHODS The National Arthritis Data Workgroup reviewed data from available surveys, such as the National Health and Nutrition Examination Survey series. For overall national estimates, we used surveys based on representative samples. Because data based on national population samples are unavailable for most specific musculoskeletal conditions, we derived data from various smaller survey samples from defined populations. Prevalence estimates from these surveys were linked to 1990 US Bureau of the Census population data to calculate national estimates. We also estimated the expected frequency of arthritis in the year 2020. RESULTS Current national estimates are provided, with important caveats regarding their interpretation, for self-reported arthritis and selected conditions. An estimated 15% (40 million) of Americans had some form of arthritis in 1995. By the year 2020, an estimated 18.2% (59.4 million) will be affected. CONCLUSION Given the limitations of the data on which they are based, this report provides the best available prevalence estimates for arthritis and other rheumatic conditions overall, and for selected musculoskeletal disorders, in the US population.

Polymyalgia rheumatica and giant-cell arteritis.

Polymyalgia rheumatica and giant-cell arteritis are closely related disorders that aff ect people of middle age and older. They frequently occur together. Both are syndromes of unknown cause, but genetic and environmental factors might have a role in their pathogenesis. The symptoms of polymyalgia rheumatica seem to be related to synovitis of proximal joints and extra-articular synovial structures. Giant-cell arteritis primarily aff ects the aorta and its extracranial branches. The clinical fi ndings in giant-cell arteritis are broad, but commonly include visual loss, headache, scalp tenderness, jaw claudication, cerebrovascular accidents, aortic arch syndrome, thoracic aorta aneurysm, and dissection. Glucocorticosteroids are the cornerstone of treatment of both polymyalgia rheumatica and giant-cell arteritis. Some patients have a chronic course and might need glucocorticosteroids for several years. Adverse events of glucocorticosteroids aff ect more than 50% of patients. Trials of steroid-sparing drugs have yielded confl icting results. A greater understanding of the molecular mechanisms involved in the pathogenesis should provide new targets for therapy.

Takayasu arteritis: A study of 32 north American patients

Thirty-two patients (26 female, 6 male) with angiographically diagnosed Takayasu arteritis were seen at the Mayo Clinic between 1971 and 1982. Racial composition of this group was 23 North American Caucasians, 4 Mexicans, 3 Orientals, 1 Native American, and 1 patient of Middle Eastern origin. Incidence of the disease in Olmsted County, Minnesota, was 2.6/million/year. Diagnosis was often delayed for long periods of time, with a median delay of 18 months. Patients had both non-vascular symptoms (arthralgias in 56%, fever in 44%, weight loss in 38%) and symptoms of vascular stenosis such as arm claudication (47%) and hypertension due to renal artery stenosis (41%). All patients had either multiple vascular bruits (94%) or absent pulses (50%). Laboratory findings included anemia (44%) and elevations of erythrocyte sedimentation rate (78%). Almost all patients had multiple sites of arterial involvement documented by angiogram with various combinations of stenosis, luminal irregularity and aneurysm formation. Response to corticosteroid treatment was usually very good, with dramatic improvement in non-vascular symptoms and return of pulses in 8 of the 16 patients with absent pulses prior to treatment. Five-year survival rate from time of diagnosis was 94%. Twelve patients underwent surgical procedures involving the carotid arteries (5 cases), subclavian artery (4 cases) and renal arteries (3 cases). Three aneurysms were resected, one had aortic valve replacement for severe aortic regurgitation, and two patients underwent transluminal angioplasty. Pathologic changes were restricted to the media and adventitial layers of the vessel wall and were indistinguishable from those of giant-cell or temporal arteritis. Takayasu arteritis is more common than previously suspected in North America, is not restricted to any one racial group, and is readily treatable with corticosteroids and surgical vascular reconstruction.

Polymyalgia Rheumatica: A 10-Year Epidemiologic and Clinical Study

Ninety-six patients with polymyalgia rheumatica were identified in Olmsted County, Minnesota, during the 10-year period 1970 to 1979. Giant cell arteritis was found in 15 of the 96 patients. The average annual incidence of polymyalgia rheumatica in the population increased from 19.8 per 100 000 in persons 50 to 59 years of age, to a maximum of 112.2 per 100 000 in persons 70 to 79 years of age. Eighty-three of the 96 patients (86%) had recovered by the end of the study. Median duration of the disease was 11 months (range, 2 to 54 months). Polymyalgia rheumatica had no effect on survival. Both corticosteroids and nonsteroidal anti-inflammatory drugs were used in treatment. Response was more rapid in patients given corticosteroids, but nonsteroidal drugs were used successfully, especially in milder cases. Relapses and adverse reactions to treatment were more frequent in patients given corticosteroids. The findings show that polymyalgia rheumatica is a relatively common disease in middle-aged and older persons and generally runs a self-limited course.

Temporal Arteritis: A 25-Year Epidemiologic, Clinical, and Pathologic Study

Among the population of Olmsted County, Minnesota, 42 patients with temporal arteritis were identified during a 25-year period. The average annual incidence per 100 000 population aged 50 and older rose from 5.1 in 1950-1959 to 17.4 in 1970-1974. The prevalence of patients with a history of the diagnosis of temporal arteritis on 1 January 1975 was 133 per 100 000 population aged 50 and older. All patients received corticosteroid therapy for a range of 1 to 77 months (median, 7 months). Relapses in 10 of 11 patients were associated with corticosteroid reduction. The majority of patients recovered fully and were followed off corticosteroids for 10 months to 19 years (median, 5 years). Temporal arteritis had no significant effect on survival. Vertebral compression fractures and myopathy were the most serious complications of therapy. The presence of giant cells in biopsies was in part related to the number of sections examined, and their presence had no apparent influence on the clinical course.

Large Artery Involvement in Giant Cell (Temporal) Arteritis

Of 248 patients with giant cell arteritis, 34 had evidence that the disease affected the aorta or its major branches. Symptoms suggestive of large artery involvement were intermittent claudication of an extremity, paresthesias, and Raynauds phenomenon. Physical findings included absent or decreased large artery pulses and bruits over large arteries. Four patients presented with decreased upper extremity pulses as the initial manifestation of their arteritis. Nine other patients under treatment for temporal arteritis or polymyalgia rheumatica first developed evidence of large artery involvement as corticosteroid therapy was tapered or discontinued. Angiography, performed in 10 patients, was helpful in indicating arteritis rather than atherosclerosis as the cause of large artery disease. Three patients died with aortic rupture, and, at autopsy, widespread giant cell arteritis was found. However, when corticosteroids were given in adequate doses, the response was favorable in most patients; intermittent claudication decreased and the pulses improved.

Primary central nervous system vasculitis: analysis of 101 patients

To analyze the clinical findings, response to therapy, outcome, and incidence of primary central nervous system vasculitis (PCNSV) in a large cohort from a single center

Tissue Cytokine Patterns in Patients with Polymyalgia Rheumatica and Giant Cell Arteritis

Giant cell (temporal) arteritis is the most frequent vasculitic syndrome, with an estimated incidence rate of 15 to 30 cases per 100 000 persons older than 50 years [1, 2]. If not treated promptly, the inflammatory process affecting the walls of medium-sized extracranial arteries results in necrosis of blood vessels and subsequent dysfunction of major organ systems. Blindness, the aortic arch syndrome, and stroke are the most serious complications, and are preventable if proper treatment is initiated. The diagnosis of giant cell arteritis is suspected in patients with clinical findings related to involved arteries (such as new-onset headaches, jaw or tongue claudication, scalp tenderness, and ischemic optic neuritis) and in patients presenting with constitutional symptoms (such as fever, malaise, weight loss, and night sweats) and severe muscle pain. Because high doses of steroids given for a prolonged period of time are the standard treatment for patients with giant cell arteritis, a definite tissue diagnosis by temporal artery biopsy is usually pursued. The characteristic histomorphologic finding for patients with giant cell arteritis consists of a lymphocyte and macrophage infiltrate in the wall of the temporal artery that may or may not include classic multinucleated giant cells [3, 4]. Because of the patchy nature of this vasculitis, an adequate biopsy specimen usually requires a minimum of a 3- to 4-cm long arterial segment and, if these biopsy results are negative, a biopsy specimen from the contralateral temporal artery is needed. The pathologic cause of the disease remains unresolved. It is not understood why macrophages and lymphocytes are recruited to the wall of medium-sized arteries and which mechanisms cause the tissue tropism of this vasculitic entity. It has been hypothesized that the inflammatory process in giant cell arteritis represents a local immune response to an unidentified antigen residing in the arterial walls [5, 6]. This model does not explain the systemic features of the disease. Polymyalgia rheumatica is a clinical syndrome closely related to giant cell arteritis [7, 8]. It is characterized by aching and morning stiffness in the neck, shoulder, and pelvic girdle muscles accompanied by systemic features such as fatigue, anorexia, and weight loss. In most patients with polymyalgia rheumatica, vasculitis cannot be shown. However, some patients develop symptoms or signs of giant cell arteritis during the course of the disease, and in about 10% to 15%, vasculitis may be found on temporal artery biopsy specimens even in the absence of recognized clinical manifestations of vasculitis [7]. The frequent co-occurrence of polymyalgia rheumatica and giant cell arteritis and the observation that both conditions affect the same population have led to the model that polymyalgia rheumatica and giant cell arteritis form a spectrum of disease. Although small doses of steroids are sufficient to relieve the symptoms in patients with polymyalgia rheumatica, high doses of steroids are required to prevent blindness and other arteritic complications in those with giant cell arteritis. Currently, no specific findings allow prediction of which patients with musculoskeletal symptoms are at risk to progress to vasculitis. Our study was designed to analyze temporal artery specimens of patients with giant cell arteritis and polymyalgia rheumatica for the local production of cytokines. Polymerase chain reaction with primer sets specific for cytokine messenger RNA (mRNA) showed that in the typical vascular lesions in patients with giant cell arteritis, mRNA of macrophage- and T-cell-derived cytokines were locally synthesized. The pattern of T-cell-derived lymphokines found in inflamed tissue indicated that a selected type of helper T cell, TH1 cell, is crucially involved in the formation of the granulomatous infiltrate. The detection of cytokine transcripts in extracts of temporal artery tissues from patients with polymyalgia rheumatica showed a subclinical inflammatory response in most of these patients that was not identified by histomorphologic test results. The pattern of cytokine mRNA synthesized in specimens from patients with polymyalgia rheumatica suggests that the local interleukin-1 and interleukin-2 production is shared by patients with polymyalgia rheumatica and giant cell arteritis, whereas the finding of interferon- is characteristic for giant cell arteritis. Methods Patients and Normal Temporal Artery Samples Forty-eight temporal artery specimens from a consecutive case series of 34 patients having biopsies were studied. Specimens from 15 patients showed an inflammatory infiltrate by standard histologic techniques, confirming the diagnosis of giant cell arteritis [3]. Nine patients without histologic evidence for giant cell arteritis had polymyalgia rheumatica based on the following criteria: at least a 4-week history of aching and morning stiffness involving two of three areas (shoulders and proximal arms, hips and proximal thighs, and neck and torso) and an erythrocyte sedimentation rate of more than 40 mm/h in the absence of any other underlying disease [7]. Ten patients did not have any inflammatory lesions suggestive of giant cell arteritis or evidence of polymyalgia rheumatica, and these patients served as controls. The ultimate diagnoses in these patients included fever of unknown origin, the myelodysplastic syndrome, diplopia, and ischemic optic neuropathy. None of the patients who had negative biopsy results had clinical findings strongly suggestive of giant cell arteritis. The demographic and clinical data of the study patients are shown in Table 1. Table 1. Characteristics of Patients Complementary DNA Synthesis and Polymerase Chain Reaction Amplification of Cytokines Ten 5- to 10-mthick sections of temporal artery biopsy specimens were lysed using 5 L of a 1% Nonidet P-40 nonionic detergent lysis solution (1% weight by volume Nonidet P-40 nonionic detergent, 10 mmol/L Tris HCl [pH 8.0], 10 mmol/L NaCl, 3 mmol/L MgCl2, and 40 units ribonuclease inhibitor [Boehringer Mannheim, Indianapolis, Indiana]). Oligo-deoxyribothymidylic acid (15mer; 50 pmol) and 8 L of diethyl pyrocarbonate-treated distilled H2O were added to the lysate. Lysates were incubated at 65 C for 5 minutes, briefly microfuged at 4 C, and placed on ice. Supernatants were moved to a new 0.5-mL Eppendorf tube leaving pelleted solid material behind. 4 L of 5 x concentrated reverse transcriptase buffer (250 mmol/L Tris HCl; 30 mmol/L MgCl2; 500 mmol/L NaCl; pH 8.2 [at 37 C]), 2 L of 0.1 mol/L 1,4-dithiothreitol, 2 L of 10 mmol/L deoxyribo-nucleotide triphosphates, 40 units of ribonuclease inhibitor, and 12 units of reverse transcriptase from avian myeloblastosis virus were all added to the lysate samples. Samples were incubated for 2 hours at 37 C. The following oligonucleotide primers were used to analyze for cytokine mRNA expression by polymerase chain reaction amplification: 1. Interleukin-1 (GACACATGGGATAACGAGGC, ACGCAGGACAGGTACAGATT). 2. Interleukin-2 (ACTCACCAGGATGCTCACAT, AGGTAATCCATCTGTTCAGA). 3. Interleukin-4 (CTTCCCCCTCTGTTCTTCCT, TTCCTGTCGAGCCGTTTCAG). 4. Interleukin-5 (ATGAGGATGCTTCTGCATTTG, TCAACTTTCTATTATCCACTCGGTGTTCATTAC). 5. Interleukin-6 (GATGTAGCCGCCCCACACAGACAG, CCTCAAACTCCAAAAGACCAGTGATG). 6. Interferon- (AGTTATATCTTGGCTTTTCA, ACCGAATAATTAGTCAGCTT). 7. Transforming growth factor- 1 (GCCCTGGACACCAACTATTGC, GCTGCACTTGCAGGAGCGCAC). 8. Tumor necrosis factor- (TCTCGAACCCCGAGTGACAA, TATCTCTCAGCTCCACGCCATT). 9. Granulocyte-macrophage-colony stimulating factor (TGGCTGCAGAGCCTGCTGCTC, TCACTCCTGGACTGGCTCCC). 10. -actin (ATCATGTTTGAGACCTTCAACACC, CATGGTGGTGCCGCCAGACAG). 11. C (GAACCCTGACCCTGCCGTGTACC, ATCATAAATTGGGGTAGGATCC). Samples were incubated at 95 C for 5 minutes and cycled for 1 minute at 94 C, 2 minutes at 55 C, and 2 minutes at 72 C for 30 cycles followed by a 10-minute extension at 72 C. Polymerase chain reaction products were reamplified for another 30 cycles by using the identical primer set and the identical amplification conditions. The amplified templates were finally separated on 2% agarose gels containing 0.1% ethidium bromide and were visualized using ultraviolet light. The sensitivity of the polymerase chain reaction approach was established on serial dilutions of freshly separated peripheral blood mononuclear cells. The polymerase chain reaction was equally sensitive to show interleukin-2, interferon-, interleukin-4, and interleukin-5 specific sequences. Statistical Analysis Patients with giant cell arteritis, polymyalgia rheumatica, and unrelated diseases were compared for the tissue expression of cytokine-specific sequences by the chi-square test or the Fisher exact probability test, if appropriate. Results Patients with Giant Cell Arteritis Expression of Macrophage-Derived Cytokines Immunohistochemical studies have shown that macrophages and CD4+ T lymphocytes are the dominant cell types in vasculitic infiltrates. To define the cytokine profile of tissue-infiltrating macrophages characteristic of giant cell arteritis, 15 temporal artery tissue specimens with typical vasculitic infiltrates were analyzed for cytokine-specific sequences by polymerase chain reaction. Tissue extracts from 16 specimens morphologically negative for inflammatory lesions from 10 patients who had unrelated diseases and who did not have clinical evidence of polymyalgia rheumatica or giant cell arteritis were examined in parallel and served as controls. A positive amplification signal for actin was used to ensure adequate RNA extraction and complementary DNA synthesis. Interleukin-1, interleukin-6, and tumor necrosis factor- constitute a group of proinflammatory cytokines predominantly synthesized by macrophages (Appendix). Granulocyte-macrophage-colony stimulating factor, also derived from macrophages, can be secreted by multiple cellular sources. Messenger RNA specific for granulocytemacrophage-colony stimulating facto

Neurologic disease in biopsy‐proven giant cell (temporal) arteritis

Neurologic findings were studied in 166 consecutive patients with biopsy-proven giant cell (temporal) arteritis. Neurologic problems occurred in 51 patients (31%): neuropathies (23), TIA/strokes (12), neuro-otologic syndromes (11), tremor (6), neuropsychiatric syndromes (5), tongue numbness (3), and myelopathy (1). Neuro-ophthalmologic problems occurred in 35 patients (21%): amaurosis fugax (AF) (17), permanent vision loss (PVL) (14), scintillating scotoma (8), and diplopia (3). Abnormalities in large arteries in 52 patients (31%) included bruits and diminished pulses. The carotid artery was involved in 31 patients (bilateral in 58%). Overall, 35% of patients with carotid disease had TIA/stroke, AF, or PVL.