Hale Ören

Etanercept for therapy‐resistant macrophage activation syndrome

Macrophage activation syndrome (MAS) is a severe, potentially fatal complication of childhood rheumatic diseases, especially systemic onset juvenile idiopathic arthritis (SoJIA). We report a 4‐year‐old girl with probable SoJIA who presented with MAS. She did not respond to pulse methyl prednisolone and Cyclosporine A (CsA). She also failed to respond to intravenous immunoglobulin (IVIG) therapy. Etanercept was started, based on the observation of increased serum levels of tumor necrosis factor‐alpha (TNF‐α) in patients with MAS. Her condition improved following etanercept, suggesting that etanercept might have a therapeutic role in resistant MAS. Pediatr Blood Cancer 2008;50:419–421.

Analyses of Polymorphism for UGT1*1 Exon 1 Promoter in Neonates with Pathologic and Prolonged Jaundice

In this study, we investigated whether a TATA box polymorphism in the promoter of the UGT1*1 exon I, the most common detected DNA polymorphism in Gilbert’s syndrome, is a contributory factor in unexplained pathologic or prolonged jaundice. 38 neonates who had unexplained pathologic jaundice, 37 neonates who had unexplained prolonged jaundice, and 35 healthy, nonjaundiced neonates were enrolled in the study. Genotypes were assigned as follows: 6/6 (homozygous for a normal allele bearing the sequence [TA]6TAA), 7/7 (homozygous for an abnormal allele with the sequence [TA]7TAA), and 6/7 (heterozygous with one of each allele). Of the 110 infants, 10 (9%) had 7/7, 51 (46%) had 6/7, and 49 (45%) had 6/6 genotype; the differences between the three groups were not statistically significant. Also no differences were observed among different genotypes and mean serum total bilirubin concentrations. In conclusion, we showed that TA 7/7 and TA 6/7 genotypes are not rare in our population and that the presence of these polymorphisms alone does not play a significant role in the etiology of unexplained pathologic or prolonged neonatal hyperbilirubinemia.

Assessment of clinical impact and predisposing factors for neonatal thrombocytopenia

Thrombocytopenia is a common hemostatic abnormality in the newborn infant. The early diagnosis of thrombocytopenia and the underlying primary pathology process play an important role in reducing the risk of severe complications and mortality. We performed a 2-year prospective study of 643 neonates admitted to our neonatology unit to determine the frequency, predisposing factors, and clinical impact of thrombocytopenia. Thrombocytopenia developed in 18.2% of the preterm neonates and 0.8% of the term neonates. Prematurity, sepsis, hypoxia, intrauterine growth retardation, and disseminated intravascular coagulation were identified as predisposing factors for thrombocytopenia. The incidence of complications and mortality were higher in thrombocytopenic infants. Especially the prognosis was worse in cases who had mucosal hemorrhage, without a relation with the degree of thrombocytopenia. The thrombocytopenia occurred by day 2 in 43% of the infants, and resolved by day 8 in 61%. The platelet count nadir occurred by day 2. Since thrombocytopenic infants are at greater risk for bleeding, and the thrombocytopenia itself may have contributed to the high mortality, predisposing factors such as prematurity, infections, hypoxia must be eliminated by prividing better care, giving adequate hygiene of both mother and the baby during the prenatal, natal, and neonatal period.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

This study demonstrates that two cases of severe ADAMTS13 deficiency are mechanistically caused by the association of two different gene defects acting at two different levels. Background In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. Design and Methods In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. Results In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. Conclusions In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Dermal bilirubin kinetics during phototherapy in term neonates

Aim: To investigate dermal bilirubin kinetics during phototherapy in the presence of neonatal indirect hyperbilirubinaemia. Methods: 33 neonates with non‐haemolytic indirect hyperbilirubinaemia, who required phototherapy, were included in the study. Phototherapy modules containing four normal and four blue fluorescent lamps were used during the study. The transcutaneous bilirubin index (TcBI) was measured in an area of the forehead covered by a 2.5 cm diameter opaque patch and a nearby exposed site. The TcBI obtained from patched and unpatched areas and simultaneous serum bilirubin (SB) concentrations were measured before the start of phototherapy and after 6, 12, 18, 30, 42 and 66 h of phototherapy. Results: SB concentration and the TcBI from the unpatched area decreased significantly during the first 6 h of exposure, while the TcBI obtained from the patched area decreased significantly after 12 h. The TcBI from the unpatched area was consistently lower than that from the patched area during phototherapy. After the onset of phototherapy, there was a weak, non‐significant correlation between SB concentrations and the TcBI from patched and unpatched areas.

Disseminated intravascular coagulation in pediatric patients: clinical and laboratory features and prognostic factors influencing the survival.

Although disseminated intravascular coagulation (DIC) has been a well-known disorder for many years, there is lack of sufficient number of clinical trials about incidence, frequency of underlying disorders, and prognosis of DIC in children. The aim of this study was to evaluate the frequency, etiologic factors, and clinical and laboratory findings of DIC and to determine the prognostic factors influencing the mortality in hospitalized pediatric patients. Medical records of 5535 children who were hospitalized were investigated. Sixty-two patients who were diagnosed as acute DIC were enrolled. The frequency of DIC was 1.12%. The underlying etiologic factors were infection in 59 patients (95.2%) and major trauma in 3 patients (4.8%). The frequency of bleeding and thrombosis was 48.8 and 4.8%. Respiratory, cardiovascular, hepatic, renal, neurologic, and gastrointestinal dysfunction was present in 71, 67.7, 35.5, 16.1, 16.1 and 11.3% of patients, respectively. Respiratory and cardiovascular dysfunctions were significantly associated with mortality. Multiorgan dysfunction syndrome (MODS) was present in 85.5% of the patients, and 54.8% of the patients had developed acute respiratory distress syndrome (ARDS). Mortality rate was significantly high in patients with MODS and ARDS. In multivariete logistic regression analysis, only ARDS and cardiovascular dysfunction had predictive and prognostic value on mortality. None of the diagnostic laboratory tests had predictive or prognostic value and the degree of abnormality of these tests did not show any correlation with mortality. In conclusion, DIC is not a rare disorder in hospitalized children, especially in patients with sepsis, and MODS, ARDS, and respiratory and cardiovascular system dysfunctions are poor prognostic factors.

Scrotal hematoma due to neonatal adrenal hemorrhage

Neonatal adrenal hemorrhage affects 0.2% of newborns and mostly due to birth-trauma, large birthweight, hypoxia, and asphyxia, but it can occur spontaneously. Clinical features are varied, depending on the amount of blood lost. The frequent clinical manifestations are anemia, persistent jaundice, and abdominal distention associated with an abdominal mass. However, some infants are asymptomatic and the diagnosis is made only incidentally. 1 Only 19 cases of neonatal adrenal hemorrhage presenting with scrotal hematoma have been described in studies so far, and unnecessary surgery was carried out in most of these cases due to suspicion of testicular torsion. 2 In this study, we present a patient with hemorrhage of the right adrenal gland, who presented with a scrotal mass, misdiagnosed as torsion of the testes, and developed disseminated intravascular coagulation (DIC), postoperatively. In this paper, the importance of preoperative diagnosis and the risk of unnecessary surgical exploration of the scrotum under general anesthesia in a newborn, are discussed.

ASSESSMENT OF PERIPHERAL LYMPHADENOPATHIES: Experience at a Pediatric Hematology-Oncology Department in Turkey

Since a large variety of disorders may lead to lymph node enlargement, determining the cause of peripheral lymphadenopathy (LAP) in children can be difficult. This retrospective study evaluated 200 children who were admitted to an Oncology-Hematology department because of lymphadenopathy and aimed to determine the clinical and laboratory findings that were valuable for differential diagnosis. A specific cause for lymphadenopathy was documented in 93 (46.5%) cases. One hundred forty (70%) children were classified as having a benign cause for lymph node enlargements. Fourteen (10%) of these cases underwent an excisional lymph node biopsy, and histopathological examination showed a reactive hyperplasia. Sixty (30%) cases were classified as having a malignant disease-causing lymphadenopathy. In terms of differential diagnosis, some associated systemic symptoms, physical findings, and laboratory investigations showed significant difference between benign and malignant lymphadenopathy groups. The following findings were determined as being important to alert the physician about the probability of a malignant disorder: location of the lymphadenopathy (supraclavicular and posterior auricular), duration of the lymph node enlargement (> 4 weeks), size of the lymph node (> 3cm), abnormal complete blood cell findings, abnormalities in chest X-ray, and abdominal ultrasonography.

Parvovirus B19: A cause for aplastic crisis and hemophagocytic lymphohistiocytosis†

A 17-year-old female patient with hereditary spherocytosis (HS) presented with fatigue, nausea, headache, and fever for 2 days. On physical examination, she had high fever, pallor, icterus, and mild splenomegaly. Peripheral blood examination demonstrated a Hb level of 8.2 g/dL, WBC 1.9 10/L, platelets 74 10/L,MCV88.9 fL,MCH33.9 pg, MCHC 38.1 g/dL, and reticulocyte 0.7%. The peripheral blood smear revealed 70% neutrophils, 18% lymphocytes, 10% monocytes and 2% band neutrophils, vacuolization in neutrophils andmonocytes;many spherocytes. Bonemarrow aspirate showed hypocellularity with many hemophagocytic histiocytes, giant proerythroblasts, and absence of mature erythroblasts, suggesting a parvovirus infection (Fig. 1). On the second day of hospitalization, her Hb level decreased to 5.6 g/dL. Hepatomegaly developed and splenomegaly progressed. Serum ferritin level was 7,478 ng/mL, triglyceride 1.17 nmol/L and fibrinogen 2.31 g/L. Prothrombin and partial thromboplastin time were within normal limits, but the D-dimer level was very high (3,004 mg/L). The serum folic acid levelwas normal. Parvovirus B19 IgMand IgGwas found to be positive by indirect immunofluoroscent assay. Secondary hemophagocytic lymphohistiocytosis (HLH) and aplastic crisis due to Parvovirus B19 infection was diagnosed. She received red blood cell transfusions and intravenous immunoglobulin was given for the HLH. Shewas discharged from the hospital after a marked clinical and hematological improvement on day 6 with a Hb level of 9.9 g/dL, WBC 4.8 10/L and platelets 198 10/L. Ten days later, her 13-year-old brother, who also had HS, presented with similar clinical features and Parvovirus B19 infection. He improved with red blood cell transfusions and supportive treatment. In patients with hemolytic anemia, with shortened red cell survival time and expanded marrow erythropoiesis, Parvovirus B19 infection can lead to a transient aplastic crisis. Giant proerythroblasts and absence of mature erythroblasts are characteristic findings of parvovirus infection [1–3].

Breast milk versus infant formulas: Effects on intestinal blood flow in neonates

The differences between breast milk and infant formulas have been a popular subject of many recent studies. Most concern the chemical and biological characteristics of breast milk and infant formulas, but little work has been done about hemodynamic changes in the splanchnic circulation. In term neonates (n=22) we evaluated the effect of breast milk, adapted cow’s milk formula, and nucleotide supplemented cow’s milk formula on intestinal blood flow. To determine the blood flow velocity and estimate volume flow, pulsed Doppler ultrasound of the superior mesenteric artery (SMA) was performed prefeeding and 15, 45, and 90 minutes following feeding. When pre-and postprandial blood flow features of babies were compared among in their groups according to nutrition post prandial blood flow velocity and volume flow were increased significantly over baseline in all three groups. While there was no significant difference between the postprandial blood flow parameters of the breast milk and adapted cow’s milk formula-fed groups, the nucleotide supplemented cow’s milk formula-fed group had significantly higher postprandial blood flow velocity and volume flow.