Hans J. Gross

UAG readthrough during TMV RNA translation: isolation and sequence of two tRNAsTyr with suppressor activity from tobacco plants

The hypothetical replicase or replicase subunit cistron in the 5′‐proximal part of tobacco mosaic virus (TMV) RNA yields a major 126‐K protein and a minor 183‐K ‘readthrough’ protein in vivo and in vitro. Two natural suppressor tRNAs were purified from uninfected tobacco plants on the basis of their ability to promote readthrough over the corresponding UAG termination codon in vitro. In a reticulocyte lysate the yield of 183‐K readthrough protein increases from ˜10% in the absence of added tobacco plant tRNA up to ˜35% in the case of pure tRNATyr added. Their amino acid acceptance and anticodon sequence (GψA) identifies the two natural suppressor tRNAs as the two normal major cytoplasmic tyrosine‐specific tRNAs. tRNATyr1 has an A:U pair at the base of the TψC stem and an unmodified G10, whereas tRNATyr2 contains a G:C pair in the corresponding location and m2G in position 10. This is the first case that, in a higher eukaryote, the complete structure is known of both the natural suppressor tRNAs and the corresponding viral RNA on which they exert their function. The corresponding codon‐anticodon interaction, which is not in accordance with the wobble hypothesis, and the possible biological significance of the readthrough phenomenon is discussed.

Inactivation of a non-enveloped RNA virus by artificial ribonucleases: Honey bees and Acute bee paralysis virus as a new experimental model for in vivo antiviral activity assessment

RNA-containing viruses represent a global threat to the health and wellbeing of humans and animals. Hence, the discovery of new approaches for the design of novel vaccines and antiviral compounds attains high attention. Here we describe the potential of artificial ribonucleases (aRNases), low molecular weight compounds capable to cleave phosphodiester bonds in RNA under mild conditions, to act as antiviral compounds via destroying the genome of non-enveloped RNA viruses, and the potential of utilizing honey bee larvae and adult bees (Apis mellifera) as a novel experimental system for the screening of new antiviral compounds. Pre-incubation of an Acute bee paralysis virus (ABPV) suspension with aRNases D3-12, K-D-1 or Dp12F6 in a concentration-dependent manner increased the survival rate of bee larvae and adult bees subsequently infected with these preparations, whereas incubation of the virus with aRNases ABL3C3 or L2-3 had no effect at all. The results of RT-PCR analysis of viral RNA isolated from aRNase-treated virus particles confirmed that virus inactivation occurs via degradation of viral genomic RNA: dose-dependent inactivation of ABPV correlates well with the cleavage of viral RNA. Electron microscopy analysis revealed that the morphology of ABPV particles inactivated by aRNases remains unaffected as compared to control virus preparations. Altogether the obtained results clearly demonstrate the potential of aRNases as a new virus inactivation agents and bee larvae/ABPV as a new in vivo system for the screening of antiviral compounds.

The magical number four: A biological, historical and mythological enigma

Precise recognition of small object numbers without counting is a widespread phenomenon. It is well documented for humans and for a series of non-human vertebrates. Recently this has been confirmed for an invertebrate, the honeybee.1 This type of inborn numerical competence has been named “subitizing”, from the Latin subito = suddenly, immediately. It differs from the classical, sequential counting which has to be trained, starting with the help of our fingers. For humans it had been established since 1871 by Jevons2 that only up to four objects are precisely recognized and memorized. Under conditions which do not allow sequential counting, mistakes start to occur in case of more than four objects. This result has been confirmed whenever the range of visual attention has been carefully tested under a variety of rigorous conditions. It provides the basis for a novel hypothesis about the evolution of counting and numbering systems in ancient civilizations.3

Terminal sequences of Sindbis virus-specific nucleic acids: identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA.

Abstract The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m 7 GpppAUAG and m 7 GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories ( Sawicki and Gomatos, 1976 ; Frey and Strauss, 1978 ). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus ( Wengler et al., 1979 ) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.

RNA ligation in eukaryotes

Abstract Two distinct enzymatic RNA ligation pathways operate in plant and animal cell extracts. They both function in tRNA splicing and possibly in other RNA processing events. Ligation of two exons during Tetrahymena pre-rRNA splicing is coupled with the excision of introns and does not require any protein.

To bee or not to bee, this is the question…: The inborn numerical competence of humans and honeybees.

Human inborn numerical competence means our ability to recognize object numbers precisely under circumstances which do not allow sequential counting. This archaic process has been called “subitizing”, from the Latin “subito” = suddenly, immediately, indicating that the objects in question are presented to test persons only for a fraction of a second in order to prevent counting. In contrast, however, sequential counting, an outstanding cultural achievement of mankind, means to count “1, 2, 3, 4, 5, 6, 7, 8 …” without a limit. The following essay will explain how the limit of numerical competence, i.e., the recognition of object numbers without counting, has been determined for humans and how this has been achieved for the first time in case of an invertebrate, the honeybee. Finally, a hypothesis explaining the influence of our limited, inborn numerical competence on counting in our times, e.g., in the Russian language, will be presented. Subitizing versus counting by young Down syndrome infants and autistics and the Savant syndrome will be discussed.

The "Clever Hans Phenomenon" revisited.

In the first decade of the 20th century, a horse named Hans drew worldwide attention in Berlin as the first and most famous “speaking” and thinking animal. Hans solved calculations by tapping numbers or letters with his hoof in order to answer questions. Later on, it turned out that the horse was able to give the correct answer by reading the microscopic signals in the face of the questioning person. This observation caused a revolution and as a consequence, experimenters avoided strictly any face-to-face contact in studies about cognitive abilities of animals—a fundamental lesson that is still not applied rigorously.