Hans W. Heidner

Alphavirus replicon particles expressing the two major envelope proteins of equine arteritis virus induce high level protection against challenge with virulent virus in vaccinated horses

Replicon particles derived from a vaccine strain of Venezuelan equine encephalitis (VEE) virus were used as vectors for expression in vivo of the major envelope proteins (G(L) and M) of equine arteritis virus (EAV), both individually and in heterodimer form (G(L)/M). The immunogenicity of the different replicons was evaluated in horses, as was their ability to protectively immunize horses against intranasal and intrauterine challenge with a virulent strain of EAV (EAV KY84). Horses immunized with replicons that express both the G(L) and M proteins in heterodimer form developed neutralizing antibodies to EAV, shed little or no virus, and developed only mild or inapparent signs of equine viral arteritis (EVA) after challenge with EAV KY84. In contrast, unvaccinated horses and those immunized with replicons expressing individual EAV envelope proteins (M or G(L)) shed virus for 6-10 days in their nasal secretions and developed severe signs of EVA after challenge. These data confirm that replicons that co-express the G(L) and M envelope proteins effectively, induce EAV neutralizing antibodies and protective immunity in horses.

Sindbis Virus Vectors Designed To Express a Foreign Protein as a Cleavable Component of the Viral Structural Polyprotein

ABSTRACT Alphavirus-based expression vectors commonly use a duplicated 26S promoter to drive expression of a foreign gene. Here we describe an expression strategy in which the foreign sequences are linked to the gene encoding the 2A protease of foot-and-mouth disease virus and then inserted in frame between the capsid and E3 genes of Sindbis virus. During replication, the 2A fusion protein is synthesized as a component of the viral structural polyprotein that is then released by intramolecular cleavages mediated by the capsid and 2A proteases. Recombinant Sindbis viruses that expressed fusion proteins composed of 2A linked to the green fluorescent protein (GFP) and to the VP7 protein of bluetongue virus were constructed. Viruses engineered to express GFP and VP7 from a duplicate 26S promoter were also constructed. All four viruses expressed the transgene and grew to similar titers in cultured cells. However, the GFP/2A- and VP7/2A-expressing viruses displayed greater expression stability and were less attenuated in newborn mice than the cognate double-subgenomic promoter-based viruses. By combining the two expression strategies, we constructed bivalent viruses that incorporated and expressed both transgenes. The bivalent viruses grew to lower titers in cultured cells and were essentially avirulent in newborn mice. Groups of mice were vaccinated with each VP7- and VP7/2A-expressing virus, and antibody responses to native VP7 were measured in an indirect enzyme-linked immunosorbent assay. Despite their genetic and phenotypic differences, all viruses induced similarly high titers of VP7-specific antibodies. These results demonstrate that 2A fusion protein-expressing alphaviruses may be particularly well suited for applications that require enduring expression of a single protein or coexpression of two alternative proteins.

Linkage of an alphavirus host-range restriction to the carbohydrate-processing phenotypes of the host cell.

The Sindbis virus mutant NE2G216 retains PE2 in place of E2 in its virion structure. NE2G216 is a host-range mutant that replicates with near-normal kinetics in vertebrate cells, but displays severely restricted growth in cultured mosquito cells (C6/36) due to defects in the virus maturation process. In this study we tested the hypothesis that the host-range phenotype of NE2G216 was linked to the differences in carbohydrate-processing phenotypes between vertebrate and arthropod cells. Arthropod cell-derived glycoproteins are distinguishable from those synthesized in vertebrate cells by the absence of complex- and hybrid-type N-linked oligosaccharides. To test our hypothesis we compared the growth of the wild-type virus, TRSB, NE2G216 and three PE2-containing, C6/36 cell-adapted variants, in vertebrate cells treated with 1-deoxymannojirimycin (1-dMM). 1-dMM inhibits the Golgi alpha-mannosidase I enzyme and limits oligosaccharide processing to high-mannose forms (Man(8-9)GlcNAc(2)). The growth of TRSB was not restricted by the action of 1-dMM; however, NE2G216 was restricted in a dose-dependent manner. In contrast, the growth of each PE2-containing, C6/36 cell-adapted mutant was enhanced by low concentrations of 1-dMM (up to 1500%) and was only slightly affected by the higher concentrations. These results demonstrate that virion maturation functions of NE2G216 are sensitive to the structure of cis-linked oligosaccharides, and indicate that the carbohydrate-processing phenotypes of the host cell can influence viral host-range and function as a selective pressure in alphavirus evolution.

Palindromes in SARS and Other Coronaviruses

With the identification of a novel coronavirus associated with the severe acute respiratory syndrome (SARS), computational analysis of its RNA genome sequence is expected to give useful clues to help elucidate the origin, evolution, and pathogenicity of the virus. In this paper, we study the collective counts of palindromes in the SARS genome along with all the completely sequenced coronaviruses. Based on a Markov-chain model for the genome sequence, the mean and standard deviation for the number of palindromes at or above a given length are derived. These theoretical results are complemented by extensive simulations to provide empirical estimates. Using a z score obtained from these mathematical and empirical means and standard deviations, we have observed that palindromes of length four are significantly underrepresented in all the coronaviruses in our data set. In contrast, length-six palindromes are significantly underrepresented only in the SARS coronavirus. Two other features are unique to the SARS sequence. First, there is a length-22 palindrome TCTTTAACAAGCTTGTTAAAGA spanning positions 25962-25983. Second, there are two repeating length-12 palindromes TTATAATTATAA spanning positions 22712-22723 and 22796-22807. Some further investigations into possible biological implications of these palindrome features are proposed.

Enhancement of vaccine efficacy by expression of a TLR5 ligand in the defined live attenuated Francisella tularensis subsp. novicida strain U112ΔiglB::fljB

Oral vaccination with the defined live attenuated Francisella novicida vaccine strain U112ΔiglB has been demonstrated to induce protective immunity against pulmonary challenge with the highly human virulent Francisella tularensis strain SCHU S4. However, this vaccination regimen requires a booster dose in mice and Exhibits 50% protective efficacy in the Fischer 344 rat model. To enhance the efficacy of this vaccine strain, we engineered U112ΔiglB to express the Salmonella typhimurium FljB flagellin D1 domain, a TLR5 agonist. The U112ΔiglB::fljB strain was highly attenuated for intracellular macrophage replication, and although the FljB protein was expressed within the cytosol, it exhibited TLR5 activation in a TLR5-expressing HEK cell line. Additionally, infection of splenocytes and lymphocytes with U112ΔiglB::fljB induced significantly greater TNF-α production than infection with U112ΔiglB. Oral vaccination with U112ΔiglB::fljB also induced significantly greater protection than U112ΔiglB against pulmonary SCHU S4 challenge in rats. The enhanced protection was accompanied by higher IgG2a production and serum-mediated reduction of Francisella infectivity. Thus, the U112ΔiglB::fljB strain may serve as a potential vaccine candidate against pneumonic tularemia.

An Arthropod Enzyme, Dfurin 1, and a Vertebrate Furin Homolog Display Distinct Cleavage Site Sequence Preferences for a Shared Viral Proprotein Substrate

Abstract n Alphaviruses replicate in vertebrate and arthropod cells and utilize a cellular enzyme called furin to process the PE2 glycoprotein precursor during virus replication in both cell types. Furin cleaves PE2 at a site immediately following a highly conserved four residue cleavage signal. Prior studies demonstrated that the amino acid immediately adjacent to the cleavage site influenced PE2 cleavage differently in vertebrate and mosquito cells (HW Heidner et al. 1996. Journal of Virology 70: 2069–2073.). This finding was tentatively attributed to potential differences in the substrate specificities of the vertebrate and arthropod furin enzymes or to differences in the carbohydrate processing phenotypes of arthropod and vertebrate cells. To further address this issue, we evaluated Sindbis virus replication and PE2 cleavage in the Chinese hamster, Cricetulus griseus Milne-Edwards (Rodentia: Cricetidae) ovary cells (CHO-K1) and in a CHO-K1-derived furin-negative cell line (RPE.40) engineered to stably express the Dfurin1 enzyme of Drosophila melanogaster Meigen (Diptera: Drosophilidae). Expression of Dfurin1 enhanced Sindbis virus titers in RPE.40 cells by a factor of 102 – 103, and this increase correlated with efficient cleavage of PE2. The PE2-cleavage phenotypes of viruses containing different amino acid substitutions adjacent to the furin cleavage site were compared in mosquito (C6/36), CHO-K1, and Dfurin1-expressing RPE.40 cells. This analysis confirmed that the substrate specificities of Dfurin1 and the putative mosquito furin homolog present in C6/36 cells are similar and suggested that the alternative PE2 cleavage phenotypes observed in vertebrate and arthropod cells were due to differences in substrate specificity between the arthropod and vertebrate furin enzymes and not to differences in host cell glycoprotein processing pathways.

The Host Range Phenotype Displayed by a Sindbis Virus Glycoprotein Variant Results from Virion Aggregation and Retention on the Surface of Mosquito Cells

ABSTRACT The Sindbis virus variant NE2G216 is a PE2-containing host range mutant that is growth restricted in cultured mosquito cells (C6/36) due to inefficient release of virions from this cell type. The maturation defect of NE2G216 has been linked to the structures of N-linked oligosaccharides synthesized by arthropod cells. Analysis of C6/36 cells infected with NE2G216 by transmission electron microscopy revealed the presence of dense virus aggregates within cytoplasmic vacuoles and virus aggregates adhered to the cell surface. The virus aggregation phenotype of NE2G216 was reproduced in vertebrate cells (Pro-5) by the addition of 1-deoxymannojirimycin, an inhibitor of carbohydrate processing which limits the processing of N-linked oligosaccharides to structures that are structurally similar, albeit not identical, to those synthesized in C6/36 cells. We conclude that defective maturation of NE2G216 in mosquito cells is due to virion aggregation and retention on the cell surface and that this phenotype is directly linked to the carbohydrate-processing properties of these cells.

An influenza A virus vaccine based on an M2e-modified alphavirus

The 23-residue external domain of the influenza A virus M2 protein (M2e) has significant potential as a vaccine antigen. Here, we describe the construction and characterization of an M2e-modified Sindbis virus designated E2S1-M2e. E2S1-M2e virions contain M2e as an N-terminal extension of the E2 glycoprotein and therefore express 240 copies of the M2e peptide on their surface. The E2S1-M2e virus expressed M2e in an accessible and immunogenic form and induced M2e-specific antibodies when administered to mice. Mice that received an intranasal vaccination with E2S1-M2e were protected against a lethal challenge with a virulent, mouse-adapted strain of influenza A virus.