Helba Bredell

CCR5 Is the Major Coreceptor Used by HIV-1 Subtype C Isolates from Patients with Active Tuberculosis

Tuberculosis (TB) is the major opportunistic infection of HIV-infected patients in developing countries and is associated with activation of the immune system and increased HIV-1 expression. The aim of this study was to explore the biological properties of HIV-1 isolates from patients with active TB. Ten HIV-1 subtype C isolates were analyzed for biological phenotypes, using MT-2 cells, and for coreceptor usage, using coreceptor-transfected cell lines. All isolates were nonsyncytium inducing (NSI) in the MT-2 assay and replicated in CCR5-expressing cells. None of the isolates used CXCR4 or any of the minor coreceptors (CCR1, CCR2b, or CCR3) efficiently. Analysis of the V3 region showed that all isolates contained the GPGQ motif characteristic of subtype C and also had a sequence profile typical of NSI viruses. These data indicate that despite their advanced disease state, patients with TB harbor viruses that use the CCR5 coreceptor. It is possible that activation of monocytes and macrophages during TB infection results in the expansion of macrophage-tropic isolates that preferentially use CCR5.

Human Immunodeficiency Virus–1 RNA Levels and CD4 Lymphocyte Counts, during Treatment for Active Tuberculosis, in South African Patients

During 6 months of treatment, we measured human immunodeficiency virus (HIV)-1 virus loads, CD4 T cell counts, and immune activation markers, in 111 HIV-1-infected patients with active tuberculosis (TB). The median virus load (baseline, 5.58 log(10) copies/mL) significantly increased at 1 month (5.71 log(10) copies/mL), then returned to near-baseline levels at 3 months (5.40 log(10) copies/mL) and at 6 months (5.36 log(10) copies/mL). In contrast, the median CD4 counts increased at 1 month (186/mm(3)), at 3 months (238/mm(3)), and at 6 months (239/mm(3)). CD4 counts and virus loads did not change during therapy. Expression of CD38 and HLA-DR remained high throughout treatment, whereas plasma levels of interleukin-6 decreased over time.

Novel and Promiscuous CTL Epitopes in Conserved Regions of Gag Targeted by Individuals with Early Subtype C HIV Type 1 Infection from Southern Africa

Characterization of optimal CTL epitopes in Gag can provide crucial information for evaluation of candidate vaccines in populations at the epicenter of the HIV-1 epidemic. We screened 38 individuals with recent subtype C HIV-1 infection using overlapping consensus C Gag peptides and hypothesized that unique HLA-restricting alleles in the southern African population would determine novel epitope identity. Seventy-four percent of individuals recognized at least one Gag peptide pool. Ten epitopic regions were identified across p17, p24, and p2p7p1p6, and greater than two-thirds of targeted regions were directed at: TGTEELRSLYNTVATLY (p17, 35%); GPKEPFRDYVDRFFKTLRAEQATQDV (p24, 19%); and RGGKLDKWEKIRLRPGGKKHYMLKHL (p17, 15%). After alignment of these epitopic regions with consensus M and a consensus subtype C sequence from the cohort, it was evident that the regions targeted were highly conserved. Fine epitope mapping revealed that five of nine identified optimal Gag epitopes were novel: HLVWASREL, LVWASRELERF, LYNTVATLY, PFRDYVDRFF, and TLRAEQATQD, and were restricted by unique HLA-Cw*08, HLA-A*30/B*57, HLA-A*29/B*44, and HLA-Cw*03 alleles, respectively. Notably, three of the mapped epitopes were restricted by more than one HLA allele. Although these epitopes were novel and restricted by unique HLA, they overlapped or were embedded within previously described CTL epitopes from subtype B HIV-1 infection. These data emphasize the promiscuous nature of epitope binding and support our hypothesis that HLA diversity between populations can shape fine epitope identity, but may not represent a constraint for universal recognition of Gag in highly conserved domains.

HIV-1 subtype C reverse transcriptase sequences from drug-naive pregnant women in South Africa.

The HIV-1 reverse transcriptase genes from 37 HIV-1-positive pregnant women attending an antenatal clinical in Soweto, South Africa were sequenced and analyzed for the presence of drug resistance mutations. All women were antiretroviral drug naive, but were being screened as potential participants in clinical trials of antiretroviral drugs aimed at preventing mother-to-child transmission. Sequence analysis revealed that all belonged to HIV-1 subtype C, the predominant subtype among heterosexual populations in South Africa. Twenty-three amino acid loci associated with resistance to zidovudine, lamivudine, didanosine, stavudine, and nevirapine were examined and found not to encode mutations that would confer resistance to these drugs. Polymorphisms at these loci occurred infrequently, with three patients harboring the A98S and V179I polymorphisms. An additional three patients harbored V118I, which can function as an accessory resistance mutation, but in this context is also likely to be a polymorphism. These data show that pregnant women who are candidates for receiving antiretroviral drug therapies do not contain naturally occurring or preexisting drug resistance mutations and that such drug therapies are likely to be highly effective in this setting.

HIV-1 Subtype A, D, G, AG and Unclassified Sequences Identified in South Africa

HIV-1 subtype C accounts for the vast majority of infections in South Africa. However, increasingly non-C subtypes are being detected. Here we report 10 viruses that contain sequences that group with subtypes A, D, and G as well as CRF02_AG and 1 that could not be classified. Most of these individuals were from other countries in Africa. Some of these sequences were in combination with subtype C, possibly indicating local recombination events. Although there is no indication of endemic spread of these viruses, continued monitoring is warranted to track genetic changes, which may impact on diagnostic testing, therapeutic responses to antiretroviral therapies, and vaccine design.

Optimization of the Oligonucleotide Ligation Assay, a Rapid and Inexpensive Test for Detection of HIV-1 Drug Resistance Mutations, for Non-North American Variants

Objective:We evaluated the feasibility of the oligonucleotide ligation assay (OLA), a specific, sensitive, and economical ligase-based point mutation assay designed to detect HIV-1 drug-resistance mutations at 12 codons of HIV-1 subtype B pol, for potential use in resource-poor settings. Methods:Specimens from HIV-1-infected individuals collected by 7 international laboratories, including subtypes A, B, C, D, F, G, J, and recombinants AE and AG, were tested by the OLA developed for HIV-1 subtype B. Common polymorphisms that interfered with reactivity of the OLA were identified and modified probes designed and evaluated. Results:92.5% (2410) of 2604 codons in specimens from 217 individuals were successfully genotyped by the subtype B OLA. A high rate (range 8.3%-31.2%) of indeterminate results (negative OLA reaction for both mutant and wild type) was observed for 5 codons. Modified probes at reverse transcriptase codons 151 and 184 and protease codon 90 increased the rate of valid OLA to 96.1%. Conclusions:The OLA designed for HIV-1 subtype B genotyped most pol codons in non-B subtypes from Asia and Africa but was improved by addition of several modified probes. International laboratories experienced in molecular techniques were able to perform the OLA.

Prevalence of Genotypic Resistance to Antiretroviral Drugs in Treatment-Naive Youths Infected with Diverse HIV Type 1 Subtypes and Recombinant Forms in Dar es Salaam, Tanzania

As human immunodeficiency virus (HIV) diversity may have an impact on both vaccine efficacy and drug resistance, it is important to have knowledge of circulating genetic variants. With widespread use of antiretroviral (ARV) drugs in Africa, one of the major potential challenges is the risk of emergence of ARV drug-resistant HIV strains. This study aimed to determine the circulating HIV subtypes and recombinant forms, as well as the prevalence of ARV drug resistance mutations, among 75 treatment-naive HIV-infected youths in Dar es Salaam, Tanzania. Gag (n = 48), partial pol (n = 44), and partial env (n = 35) sequencing was performed; all three regions were sequenced in 26 samples. Evidence of infection with recombinant viruses was found in 12 (46%) participants; AC recombinants were the most commonly detected and they were identified in six (23%) participants. Of individuals infected with nonrecombinant strains, subtype A was most commonly detected in seven (27%) participants, followed by subtype C detected in six (23%) participants and subtype D detected in one (4%) participant. Among the pol sequences from 44 individuals, three (7%) had resistance to nucleoside reverse transcriptase (RT) inhibitors and four (9%) had nonnucleoside RT inhibitor resistance mutations. Of these, three (7%) individuals were infected with viruses with cross-resistance mutations to both classes of RT inhibitors. These resistant mutations were all associated with drugs currently used in first-line therapy and in the prevention of vertical transmission. This high prevalence of resistance mutations is of considerable concern in apparently drug-naive populations as it may result in treatment failure and the spread of ARV-resistant strains.

Identification of HIV type 1 intersubtype recombinants in south africa using env and gag heteroduplex mobility assays

493 G EN E TIC D IVER SITY is a major characteristic of the human immunodeficiency virus type 1 (HIV-1). On the basis of nucleotide sequence analysis the HIV-1 group M srains are phylogenetically grouped into 10 distinct subtypes, almost all of which have been found in Central Africa.1 Recombination between different subtypes respresents an important means by which HIV-1 generates genetic diversity. More than 10% of full gene regions or full HIV-1 genome sequences in the database appear to be intersubtype recom binants,2 although studies indicate that the prevalence in some countries in Africa may be as high as 25%.3 In South Africa, the epidemic is dominated by subtype C viruses transm itted mainly through heterosexual contact.4,5 A smaller epidemic, which peaked in the mid-1980s among homosexual/ bisexual men, is associated with subtype B and a few subtype D infections. 6 More recently two subtype A infections have been docum ented.5 Previous studies have not revealed the existence of recombinant viruses in South Africa.7 In this study a gag heteroduplex mobility assay (HMA) was developed to complement the env HMA to facilitate HIV subtype determination in two regions of the genom e and to identify intersubtype recom binant viruses. We describe the identification of HIV-1 subtypes A, B, and C, and the relatively low prevalence of intersubtype recombinants, in South Africa. Between 1995 and 1998 blood was collected from 172 HIV1-seropositive individuals representing different HIV risk groups. Except for seven commercial sex workers from KwaZulu-Natal, all samples were from Johannesburg. Signed informed consent was obtained from all study subjects prior to collection of blood and the majority of patients were interviewed for demographic information including route and place of transmission. Specifically, this included patients admitted with tuberculosis and other AIDS-defining illnesses, individuals attending hemophiliac or antenatal clinics, immigrant and mobile persons using urban AIDS clinics, as well as individuals under the care of private physicians. There was a similar number of men (n 5 84) and women (n 5 88) in the cohort, with ages ranging from 18 to 59 years. The majority of individuals were infected through heterosexual contact, followed by blood transfusion, homosexual transmission, intravenous drug use, and occupational exposure. CD4 1 lymphocyte counts were determined in 117 individuals, 52% of whom had fewer than 200 CD4 1 T cells/ m l, indicating that they had advanced disease. This cohort does not reflect the HIV infection rates across the different risk groups, but rather an attempt to sample different risk groups. Peripheral blood mononuclear cells (PBMCs) were isolated and used to amplify an , 700-bp product in the gp120 V3–V5 region for use in an env HMA as described previously. 4 The same cellular lysates were used to amplify an , 520-bp product comprising 100 bp in the long terminal repeat (LTR) region and the whole p17 gag gene. For this, outer primers MSF12 (5 9 AAATCTCTAGCAGTGGCGCCCGAACAG at positions 622 to 648 of the HXB2 genome)8 and SK431 (5 9 AGAGAACCAAGGGGAAGTGACATAGCAGG at positions 1475 to 1503)9 and inner primers LTR236 (5 9 CGCAGGACTCGGCTTGC at positions 688 to 704) and gag 778 (5 9 CACCTAGAACTTTAAATGCATGGG at positions 1231 to 1254)10 were used. Five microliters of DNA input was used in the firstand second-round amplification in a reaction mixture containing 10 pmol of each primer, 200 m M dNTPs, 1.5 mM MgCl2, and 0.625 U of Super-Therm DNA polymerase with supplied 10 3 buffer (Advanced Biotechnologies Limited, UK). The following HIV-1 isolates provided by the NIH AIDS Research and Reference Reagent Program (Rockville, MD) were used as subtype preferences: 92RW009A (gag C/env A), 92UG029 (A/A), 92BR021B (B/B), 92BR025 (C/C), and 92UG001 (D/D). The amplification reactions were performed in a Perkin-Elmer (Norwalk, CT) Thermocycler 2400 or 9600 for 28 cycles under the following conditions: 3 cycles at 94°C for 2 min, 45°C for 2 min, and 72°C for 4 min; 25 cycles at 94°C for 45 sec, 45°C for 1 min, and 72°C for 1.5 min; and a final extension at 72°C for 7 min. A gag HMA was performed essentially as described

Rapid, complex adaptation of transmitted HIV-1 full-length genomes in subtype C-infected individuals with differing disease progression

Objective(s):There is limited information on full-length genome sequences and the early evolution of transmitted HIV-1 subtype C viruses, which constitute the majority of viruses spread in Africa. The purpose of this study was to characterize the earliest changes across the genome of subtype C viruses following transmission, to better understand early control of viremia. Design:We derived the near full-length genome sequence responsible for clinical infection from five HIV subtype C-infected individuals with different disease progression profiles and tracked adaptation to immune responses in the first 6 months of infection. Methods:Near full-length genomes were generated by single genome amplification and direct sequencing. Sequences were analyzed for amino acid mutations associated with cytotoxic T lymphocyte (CTL) or antibody-mediated immune pressure, and for reversion. Results:Fifty-five sequence changes associated with adaptation to the new host were identified, with 38% attributed to CTL pressure, 35% to antibody pressure, 16% to reversions and the remainder were unclassified. Mutations in CTL epitopes were most frequent in the first 5 weeks of infection, with the frequency declining over time with the decline in viral load. CTL escape predominantly occurred in nef, followed by pol and env. Shuffling/toggling of mutations was identified in 81% of CTL epitopes, with only 7% reaching fixation within the 6-month period. Conclusion:There was rapid virus adaptation following transmission, predominantly driven by CTL pressure, with most changes occurring during high viremia. Rapid escape and complex escape pathways provide further challenges for vaccine protection.

Intra- and Inter-clade Cross-reactivity by HIV-1 Gag Specific T-Cells Reveals Exclusive and Commonly Targeted Regions: Implications for Current Vaccine Trials

The genetic diversity of HIV-1 across the globe is a major challenge for developing an HIV vaccine. To facilitate immunogen design, it is important to characterize clusters of commonly targeted T-cell epitopes across different HIV clades. To address this, we examined 39 HIV-1 clade C infected individuals for IFN-γ Gag-specific T-cell responses using five sets of overlapping peptides, two sets matching clade C vaccine candidates derived from strains from South Africa and China, and three peptide sets corresponding to consensus clades A, B, and D sequences. The magnitude and breadth of T-cell responses against the two clade C peptide sets did not differ, however clade C peptides were preferentially recognized compared to the other peptide sets. A total of 84 peptides were recognized, of which 19 were exclusively from clade C, 8 exclusively from clade B, one peptide each from A and D and 17 were commonly recognized by clade A, B, C and D. The entropy of the exclusively recognized peptides was significantly higher than that of commonly recognized peptides (p = 0.0128) and the median peptide processing scores were significantly higher for the peptide variants recognized versus those not recognized (p = 0.0001). Consistent with these results, the predicted Major Histocompatibility Complex Class I IC50 values were significantly lower for the recognized peptide variants compared to those not recognized in the ELISPOT assay (p<0.0001), suggesting that peptide variation between clades, resulting in lack of cross-clade recognition, has been shaped by host immune selection pressure. Overall, our study shows that clade C infected individuals recognize clade C peptides with greater frequency and higher magnitude than other clades, and that a selection of highly conserved epitope regions within Gag are commonly recognized and give rise to cross-clade reactivities.