Hiroshi Tanooka

Localization of glutathione and induction of glutathione synthesis- related proteins in mouse brain by low doses of γ-rays

First, we determined the cerebral localization of reduced glutathione (GSH) in normal mice by means of autoradiography using 99mTc-meso-hexamethyl propylene oxime. A highly specific localization of GSH in the cerebellum and hippocampus was observed. Secondly, we measured the elevation of GSH level in the brain after low-dose gamma-irradiation. The cerebral GSH levels increased soon after irradiation with 50 cGy of gamma-rays, reaching a maximum at 3 h post-treatment, then remaining significantly higher than that of the non-irradiated control until 12 h and returning to the control level by 24 h. Thirdly, we examined the induction of the activities and the mRNAs of proteins involved in the synthesis and regeneration of GSH in the brain of mice subjected to low-dose gamma-ray irradiation. The level of mRNA for gamma-glutamylcysteine synthetase was significantly increased at 0.5 h, and remained high until 2 h post-irradiation (50 cGy). The level was transiently lowered to the non-irradiated control level at 3 h and slightly increased again after 6 h post-irradiation. gamma-Glutamylcysteine synthetase activity was significantly increased 3 h after irradiation, and remained high up to 24 h post-irradiation. As for glutathione reductase, the mRNA level was increased at 0.5 h, and peaked strongly at 2 h, while the enzyme activity was significantly increased at 6 h after irradiation, and continued to increase up to 24 h. The level of mRNA for thioredoxin, which contributes to GSH biosynthesis by supplying cysteine to the de novo pathway, peaked between 0.5 h and 2 h post-irradiation, and rapidly declined thereafter. The content of thioredoxin showed a transient decrease immediately after irradiation, but was then remarkably elevated, reaching a maximum at 3 h, and thereafter declining sharply. These results indicate that the increase in endogenous GSH in mouse brain soon after low-dose gamma-ray irradiation is a consequence of the induction of GSH synthesis-related proteins and occurs via both the de novo synthesis and the regeneration pathways.

Threshold-like dose of local beta irradiation repeated throughout the life span of mice for induction of skin and bone tumors.

The backs of female ICR mice were irradiated with beta rays from 90Sr-90Y three times a week throughout life. Previously we observed 100% tumor incidence at five different dose levels ranging from 1.5 to 11.8 Gy per exposure, but no tumor on repeated irradiation with 1.35 Gy for 300 days (Radiat. Res. 115, 488, 1988). In the present study, delay of tumor development was again seen at a dose of 1.5 Gy per exposure, with further delay at 1.0 Gy. The final tumor incidence was 100% with these two doses. At 0.75 Gy per exposure, no tumor appeared within 790 days after the start of irradiation, but one osteosarcoma and one squamous cell carcinoma did finally appear. These findings indicate a threshold-like response of tumor induction in this repeated irradiation system and further suggest that the apparent threshold may be somewhat less than 0.75 Gy per exposure.

Possible inactivation of part of chromosome 13 due to 13qXp translocation associated with retinoblastoma.

Chromosome examination of a female patient with 13/X translocation associated with retinoblastoma was carried out using peripheral blood lymphocytes and cultured skin fibroblasts. The constitutional karyotype was 46,X,t(l 3;X) (q12;p22). Q‐banding analysis showed that the translocated chromosomes were of paternal origin. Studies on DNA replication pattern with Giemsa banding using the bromodeoxyuridine substitution technique revealed that the derivative X chromosome was late replicating, and the translocated chromosome 13 was affected by the spreading of lyonization. Such a functional monosomy of 13q14 may also be involved in retinal blasts, and be related to the development of retinoblastoma.

Induction of thioredoxin in human lymphocytes with low-dose ionizing radiation

Induction of the expression of the thioredoxin (TRX) gene, producing a key protein in regulating cellular functions through redox reaction as well as being a radioprotector, was followed after ionizing irradiation of lymphocytes from human donors. The TRX mRNA level increased to a peak, 5.7-fold higher than the control at maximum, 6 h after irradiation, and then decreased. The optimum radiation dose for enhancement of induction of the TRX mRNA was 0.25 Gy. The TRX protein also increased to a peak, a 3-fold increase at maximum, with the same timing as that for TRX mRNA.

Zero tumor incidence in mice after repeated lifetime exposures to 0.5 Gy of beta radiation

A final series of experiments on tumor induction by repeating 90Sr-90Y beta irradiation of the back of ICR mice three times weekly throughout the life span showed no tumor incidence with repeated doses of 0.5 Gy per exposure. The whole dose-response relationship for repeated irradiation with 0.5 to 11.8 Gy per exposure, summarized along with data obtained previously, showed a unique nonlinear dose response with saturation of tumor incidence at doses of over 2.5 Gy per exposure and a threshold-like value around 1.5 Gy per exposure.

Increase in copy number of N-myc in retinoblastomas in comparison with chromosome abnormality☆

N-myc oncogene amplification was studied in tumor tissue DNA from Japanese retinoblastoma patients, taking into consideration their uni- or bilateral disease form, their family history, and any chromosome abnormalities. Of the 23 cases examined, seven (30%) showed a 1.9- to 2.3-fold amplification of N-myc. No correlation was found between N-myc amplification and either tumor form or family history. Two of three cases having double minute bodies in their tumors showed N-myc amplification. In two tumors with 13q deletions, one produced in the host with constitutional 13q--abnormality showed no N-myc amplification, and the other one produced in the host with normal karyotype showed an N-myc amplification. These results indicate N-myc amplification is independent of the known genetic background in retinoblastoma patients.

Delayed induction of ornithine decarboxylase in mouse skin after irradiation with beta-rays.

Irradiation with 90Sr-90Y beta rays induced ornithine decarboxylase (ODC) activity in mouse skin. Maximum activity appeared after about 17 days, at the time of appearance of skin injuries. These findings suggest the presence of tumor-promoting activity of beta rays.

Distribution of the p53 pseudogene among mouse species and subspecies

Pseudogenes may provide a useful marker for molecular taxonomy, since the rate of nucleotide substitutions for pseudogenes is much higher than that for functional genes (Nei 1987). The present article gives evidence that the p53 pseudogene is useful for classification of mouse subspecies. Gene p53 (Trp53) is a tumor suppressor gene (Harris 1993) and is the most frequently mutated gene in human tumors (Holstein et al. 1991). Its role in regulating the cell cycle is now becoming clear (Marx 1993; Friend 1994), and its molecular evolution has been determined (Soussi et al. 1990). The pseudogene of p53 (Trp53-ps) is present in laboratory mice (Zakut-Houri et al. 1983) on Chromosome 14 (Czosnek et al. 1984) and in rats (Hulla and Schneider 1993), but is absent in humans so far as known. A variant of the mouse p53 pseudogene has been found in the structme of exon 8 (Kominami et al. 1991). Mus musculus subspecies have been classified by polymorphism of various markers, i.e., mitochondrial DNA restriction pattern (Yonekawa et al. 1981; Ferris et al. 1983), biochemical markers (Bonhomme et al. 1984), chromosome C-band pattern (Moriwaki et al. 1986), the 28S ribosomal RNA gene (Suzuki et al. I986), the major histocompatibility complex and other markers (Moriwaki et al. 1990). In the present study, we examined DNA of various wild mice captured at different localities for p53 psendogene variation, to gain information on the origin and evolution of mice. Mouse DNA samples were obtained from the collection of wild mouse DNAs maintained at the National Institute of Genetics, Japan. Molecular techniques followed the methods described by Maniatis et al. (1982). The DNA samples were tested for the presence or absence of the p53 pseudogene by amplification of the exon 4-5 region (codons 36-192, including the 5 end of exon 6) by the polymerase chain reaction (PCR), using primers 5CCATCACCTCACTGCATGGA and 5 TAAGATGCTGGGGAGGAGCC, followed by electrophoresis in a 3% agarose gel. The pseudogene and the functional gene of p53 were separated into two distinct bands on the gel (Fig. 1). The functional p53 gene did not prevent observation of the pseudogene because of the presence of two introns, intron 4 (780 bp) and intron 5 (78 bp) (Goodrow et al. 1992), which gave a longer fragment of the p53 functional gene. The p53 pseudogene fragments were sequenced by the double-strand DNA cycle sequencing system (GIBCO BRL, Gaithersburg, Md. USA) and polyacrylamide-gel electrophoresis. We found that the p53 pseudogene was present in eight samples and absent in 14 samples (Fig. 1). The absence of the p53

Threshold-like Dose Response of Mouse Skin Cancer Induction by Repeated Beta Irradiation and its Relevance to Radiation-Induced Human Skin Cancer

“Repeated irradiation gives rise to a unique threshold-type dose response in skin tumor induction.” This statement is the main subject of this paper. Although information on radiation-induced tumors has been accumulated from experimental data (Upton et al. 1986), most has come from experiments using a single exposure or a few fractionated exposures to radiation. Estimation of radiation risk for humans is mainly based upon data obtained from cases of single exposure: very few data are available on the dose-response relationship of tumor incidence to continuous or repeated exposures to radiation. However, such data are necessary for evaluating the risk of continuous exposure of humans to environmental radiation.

DIRECT AND INDIRECT INACTIVATION OF BACTERIOPHAGE T6 CONTAINING HALOGENATED DNA

ABS>In broth, the x-ray sensitivity of the bacteriophage T6 was doubled when 5-bromodeoxyuridine or 5-iododeoxyuridine (BUDR or IUDR) was incorporated. In an aqueous suspension, the immediate and delayed inactivation of phage by x irradiation did not show a significant difference between control, BUDR- incorporated, and IUDR-incorporated phage. This finding supports the view that the phage DNA is a principal target of the direct action of ionizing radiation, whereas the outer coat of the phage is a principal target of the indirect action. X irradiation of aqueous solutions of the critical molecules thymidine, BUDR, and IUDR showed the same degree of optical density decrease with increasing x-ray dose. This indicates that the ring structures of thymidine, BUDR, and IUDR are equally sensitive to radical attack. (auth)