Honglin Zhu

Resveratrol attenuates doxorubicin-induced cardiomyocyte apoptosis in mice through SIRT1-mediated deacetylation of p53

AIMS Doxorubicin (DOX) is an anthracycline drug with a wide spectrum of clinical antineoplastic activity, but increased apoptosis has been implicated in its cardiotoxicity. Resveratrol (RES) was shown to harbour major health benefits in diseases associated with oxidative stress. In this study, we aimed to determine the effect of RES on DOX-induced myocardial apoptosis in mice. METHODS AND RESULTS Male Balb/c mice were randomized to one of the following four treatments: saline, RES, DOX, or RES plus DOX (10 mice in each group). DOX treatment markedly depressed cardiac function, decreased the heart weight, the body weight, and the ratio of heart weight to body weight, but inversely increased the level of protein carbonyl, malondialdehyde, and serum lactate dehydrogenase, and induced mitochondrial cytochrome c release and cardiomyocyte apoptosis. However, these effects of DOX were ameliorated by its combination with RES. Further studies with a co-immunoprecipitation assay revealed an interaction between p53 and Sirtuin 1 (SIRT1). It was found by western blot and electrophoretic mobility shift assay that DOX treatment increased p53 protein acetylation and cytochrome c release from mitochondria, activated p53 binding at the Bax promoter, and up-regulated Bax expression, but supplementation with RES could weaken all these effects. CONCLUSION The protective effect of RES against DOX-induced cardiomyocyte apoptosis is associated with the up-regulation of SIRT1-mediated p53 deacetylation.

MicroRNA Expression Abnormalities in Limited Cutaneous Scleroderma and Diffuse Cutaneous Scleroderma

Scleroderma (systemic sclerosis, SSc) is a complex autoimmune disease caused by progressive fibrotic replacement of normal tissue architecture, a progressive and ultimately fatal process that currently has no cure. Although dysregulation of microRNAs (miRNAs) is known to be involved in a variety of pathophysiologic processes, the role of miRNAs in SSc is unclear. In comparison with the normal skin tissues, miRNAs were aberrantly expressed in limited cutaneous scleroderma and diffuse cutaneous scleroderma skin tissues. We also identified miRNAs whose expressions were correlated with SSc fibrosis: miR-21, miR-31, miR-146, miR-503, miR-145, and miR-29b were predicted to be involved. This study further confirmed that miR-21 was increased whereas miR-145 and miR-29b were decreased both in the skin tissues and fibroblasts. As predicted target genes, SMAD7, SAMD3, and COL1A1 were regulated by these miRNAs. After stimulation with transforming growth factor β, the expression of miR-21 was increased and that of SMAD7 mRNA was decreased. MiR-145 was upregulated whereas the mRNA level of SMAD3 was downregulated. The downregulation of miR-29b was correlated with the upregulation of COL1A1 mRNA. MiRNAs might play an important role in the pathogenesis of SSc and suggest a potential therapy.

MicroRNA-21 in Scleroderma Fibrosis and its Function in TGF-β- Regulated Fibrosis-Related Genes Expression

Uncontrolled fibrosis in multiple organs is the main cause of death in systemic sclerosis (SSc), and transforming growth factor-β (TGF-β) activation plays a fundamental role in the process. Our previous study demonstrated that miR-21 was significantly up-regulated in SSc fibroblasts. Here, we found that TGF-β regulated the expression of miR-21 and fibrosis-related genes, and decreased Smad7 expression. Over-expression of miR-21 in fibroblasts decreased the levels of Smad7, whereas knockdown of miR-21 increased its expression. Further study using a reporter gene assay demonstrated Smad7 was a direct target of miR-21. Similar to human SSc, the expression of miR-21 increased in the bleomycin induced skin fibrosis. Inhibition of fibrosis by treatment with anti-fibrosis drug bortezomib restored the levels of miR-21 and Smad7. MiR-21 may function in an amplifying circuit to enhance TGF-β signaling events in SSc fibrosis, and suggesting that miR-21 may act as a potential therapeutic target.Uncontrolled fibrosis in multiple organs is the main cause of death in systemic sclerosis (SSc), and transforming growth factor-β (TGF-β) activation plays a fundamental role in the process. Our previous study demonstrated that miR-21 was significantly up-regulated in SSc fibroblasts. Here, we found that TGF-β regulated the expression of miR-21 and fibrosis-related genes, and decreased Smad7 expression. Over-expression of miR-21 in fibroblasts decreased the levels of Smad7, whereas knockdown of miR-21 increased its expression. Further study using a reporter gene assay demonstrated Smad7 was a direct target of miR-21. Similar to human SSc, the expression of miR-21 increased in the bleomycin induced skin fibrosis. Inhibition of fibrosis by treatment with anti-fibrosis drug bortezomib restored the levels of miR-21 and Smad7. MiR-21 may function in an amplifying circuit to enhance TGF-β signaling events in SSc fibrosis, and suggesting that miR-21 may act as a potential therapeutic target.

MicroRNA-130b regulates scleroderma fibrosis by targeting peroxisome proliferator-activated receptor γ.

Abstract Objectives. To investigate the role of microRNA-130b (miR-130b) in systemic sclerosis (SSc) skin fibrosis and its regulatory effect on peroxisome proliferator-activated receptor γ (PPARγ). Methods. miR-130b was identified from microarray analyses in our previous studies. The expression of miR-130b, PPARγ, and fibrosis-related genes were determined by real-time PCR analysis. PPARγ protein levels were detected by immunohistochemistry and Western blot. Cells were transfected with microRNA mimics/inhibitor/scramble of miR-130b using Lipofectamine. Luciferase reporter gene assays were used to identify the direct target of miR-130b. Transforming growth factor β (TGF-β) was used for stimulation. Results. The expression of miR-130b was significantly upregulated and level of PPARγ was decreased in the dermis of the SSc skin biopsy samples and fibroblasts. Similar to human SSc, the same expression patterns of miR-130b, PPARγ, and fibrosis-related genes were observed in the bleomycin-induced skin fibrosis model; TGF-β induced the expression of miR-130b and fibrosis-related genes expression, but downregulated the expression of PPARγ. Overexpression of miR-130b in normal or SSc skin fibroblasts significantly decreased, and accordingly, knockdown of miR-130b increased the levels of PPARγ and fibrosis-related genes. In the reporter gene assay, cotransfection with miR-130b mimics significantly decreased the relative luciferase activity, which suggested a direct regulation of PPARγ by miR-130b. Conclusions. These studies demonstrated that miR-130b played important profibrotic roles in SSc fibrosis, and enhanced TGF-β signaling through negative regulation of PPARγ expression. MiR-130b may be a potential therapeutic target in SSc fibrosis.

Constitutive heat shock protein 70 interacts with α-enolase and protects cardiomyocytes against oxidative stress.

Abstract Constitutive heat shock protein 70 (Hsc70) is a molecular chaperone that has been shown to protect cardiomyocytes against oxidative stress. However, the molecular mechanism responsible for this protection remains uncertain. To understand the mechanism associated with the myocardial protective role of Hsc70, we have embarked upon a systematic search for Hsc70-interacting proteins. Using adenosine diphosphate (ADP) affinity chromatography and mass spectrometry, we have identified α-enolase, a rate-limiting enzyme in glycolysis, as a novel Hsc70-interacting protein in the myocardium of both sham and myocardial ischemia-reperfused Sprague–Dawley rat hearts. This interaction was confirmed by co-immunoprecipitation (IP) assays in the myocardial tissues and H9c2 cardiomyocytes and protein overlay assay (POA). It was further shown that Hsc70-overexpression alleviated the H2O2-induced decrease of α-enolase activity and cell damage, and Hsc70 deficiency aggravated the decrease of α-enolase activity and cell damage in H2O2 treated H9c2 cells. Our research suggests that the protective effect of Hsc70 on the cardiomyocytes against oxidative stress is partly associated with its interaction with α-enolase.

Oxidative stress-mediated up-regulation of myocardial ischemic preconditioning up-regulated protein 1 gene expression in H9c2 cardiomyocytes is regulated by cyclic AMP-response element binding protein

The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H(2)O(2) stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H(2)O(2) resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H(2)O(2) increased phosphorylation of CREB serine 133 through a pathway involving PKA activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H(2)O(2) treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H(2)O(2)-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H(2)O(2)-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by cAMP/PKA-dependent CREB activation.

A novel WD-repeat protein, WDR26, inhibits apoptosis of cardiomyocytes induced by oxidative stress

Abstract WD40 repeat proteins have a variety of functions, such as signal transduction, transcription regulation, cell cycle control, autophagy and apoptosis. WDR26 is a novel protein of WD40 repeat proteins and up-regulated during myocardial cells ischemic preconditioning (IPC) but its role in myocardial cell apoptosis induced by oxidative stress and its subcellular localisation are not clear. So we investigated the subcellular localisation of WDR26 and WDR26 expression in rat myocardial ischaemia-reperfusion injury model and H9c2 cells stimulated by H2O2. The results showed that WDR26 can be located at mitochondria and induced by ischaemia-reperfusion injury and H2O2. Then we examined the effects induced by H2O2 in H9c2 cells WDR26 expression. The results showed that WDR26 expression can inhibit apoptosis induced by H2O2. Further, we demonstrated that WDR26 inhibit cytochrome c release from mitochondria. These founding indicate that WDR26 protects myocardial cells against oxidative stress.

MicroRNA-202-3p regulates scleroderma fibrosis by targeting matrix metalloproteinase 1

The leading cause of death in systemic sclerosis (SSc) is the uncontrolled fibrosis in multiple organs. The exact mechanism of fibrosis is not fully clear. Our previous studies using miRNA array analysis indicated that miR-202-3p was increased in SSc lesion skin tissues. Bioinformatics analysis suggested matrix metallopeptidase (MMP) 1 is the target gene of miR-202-3p. Here we confirmed that miR-202-3p was upregulated, and the mRNA and protein expression of MMP1 were significantly decreased in SSc skin tissues and primary fibroblast compared with normal skin. MMP1 expression was inversely correlated with the expression of miR-202-3p. Overexpression of miR-202-3p markedly increased collagen disposition in skin primary fibroblasts, while inhibitor of miR-202-3p decreased it. Furthermore, we demonstrated that MMP1 was a target of miR-202-3p detected by luciferase reporter assay, and played an essential role as a mediator of the biological effects of miR-202-3p in SSc fibrosis. Taken together, these findings suggest that miR-202-3p may function as a novel pro-fibrotic miRNA in SSc by inhibition the expression of MMP1.

Using multi-omics methods to understand dermatomyositis/polymyositis

Idiopathic inflammatory myopathies (IIM) are a group of rare and heterogeneous autoimmune diseases, and the most common subtypes are dermatomyositis (DM) and polymyositis (PM). Despite extensive efforts, the underlying mechanism of IIM remains unclear. Recent efforts to understand the pathogenesis of IIM have included genomics, epigenetics, transcriptomics, proteomics and autoantibody studies. This review focuses on recent studies in DM/PM research based on multi-omics. This integrated analysis of multi-omics profiling will provide useful insights into DM/PM pathogenesis and recommendations for therapeutic targets and biomarkers development.

HSP25 down-regulation enhanced p53 acetylation by dissociation of SIRT1 from p53 in doxorubicin-induced H9c2 cell apoptosis

Heat shock proteins (HSPs) play important roles in cellular stress resistance. Previous reports had already suggested that HSP27 played multiple roles in preventing doxorubicin-induced cardiotoxicity. Although HSP25 might have biological functions similar to its human homolog HSP27, the mechanism of HSP25 is still unclear in doxorubicin-induced cardiomyocyte apoptosis. To investigate HSP25 biological function on doxorubicin-induced apoptosis, flow cytometry was employed to analyze cell apoptosis in over-expressing HSP25 H9c2 cells in presence of doxorubicin. Unexpectedly, the H9c2 cells of over-expressing HSP25 have no protective effect on doxorubicin-induced apoptosis. Moreover, no detectable interactions were detected by coimmunoprecipitation between HSP25 and cytochrome c, and HSP25 over-expression failed in preventing cytochrome c release induced by doxorubicin. However, down-regulation of endogenous HSP25 by a specific small hairpin RNA aggravates apoptosis in H9c2 cells. Subsequent studies found that HSP25, but not HSP90, HSP70, and HSP20, interacted with SIRT1. Knockdown of HSP25 decreased the interaction between SIRT1 and p53, leading to increased p53 acetylation on K379, up-regulated pro-apoptotic Bax protein expression, induced cytochrome c release, and triggered caspase-3 and caspase-9 activation. These findings indicated a novel mechanism by which HSP25 regulated p53 acetylation through dissociation of SIRT1 from p53 in doxorubicin-induced H9c2 cell apoptosis.